Image dna SNP.svg thumb DNA molecule 1 differs from DNA molecule 2 at a single base pair location a C T polymorphism . Multiple issues refimprove March 2011 primarysources March 2011 A singlenucleotidepolymorphism SNP , pronounced snip is a DNA sequence variation occurring when a singlenucleotide ... region Synonymous Nonsynonymous Missense Nonsense Singlenucleotidepolymorphism biology polymorphisms ... open SNP genetics DEFAULTSORT SingleNucleotidePolymorphism Category Molecular biology Category ... cs Jednonukleotidov polymorfismus da Enkeltnukleotidpolymorfi de SingleNucleotidePolymorphism et ... in a singlenucleotide. In this case we say that there are two allele s C and T. Almost all common ... allele frequencies for singlenucleotide polymorphisms. There are variations between human populations ... singlenucleotide polymorphisms journal Nature volume 409 issue 6822 pages 928 33 year 2001 pmid 11237013 doi 10.1038 35057149 ref A single SNP may cause a Genetic disorder Mendelian disease . For Genetic ... first2 S.N. title Identification of base pairs in singlenucleotide polymorphisms by MutS protein ... analysis of singlenucleotide polymorphisms ternary encoding of genotypes. journal Analytical chemistry pmid 10939403 pages 3298 302 issue 14 volume 72 year 2000 doi 10.1021 ac991390e ref single strand conformation polymorphism SSCP electrochemical analysis denaturating HPLC and gel electrophoresis restriction fragment length polymorphism hybridization analysis See also Single base extension SNP ... of genetic variations. For example, a single base difference in the Apolipoprotein E is associated ... polymorphism sometimes called a silent mutation . If a different polypeptide sequence is produced the polymorphism is a replacement polymorphism . A replacement polymorphism change may be either ... and greater than sign showing the wild type and altered nucleotide or amino acid for example, c.76A ... search http www.ncbi.nlm.nih.gov projects SNP NCBI dbSNP database a central repository for both single ... more details
Single strand conformation polymorphism SSCP , or single strand chain polymorphism, is defined as conformational difference of single stranded DNA nucleotide sequences of identical length as induced by differences in the sequences under certain experimental conditions. This property allows to distinguish the sequences by means of gel electrophoresis , which separates the different conformations. Physical background A singlenucleotide change in a particular sequence, as seen in a double stranded DNA, cannot be distinguished by electrophoresis, because the physical properties of the double strands are almost identical for both alleles. After denaturation, single stranded DNA undergoes a 3 dimensional folding and may assume a unique conformational state based on its DNA sequence. The difference in shape between two single stranded DNA strands with different sequences can cause them to migrate differently on an electrophoresis gel, even though the number of nucleotides is the same, which is, in fact, an application of SSCP. Applications in molecular biology SSCP used to be a way to discover new DNA polymorphisms apart from DNA sequencing, but is now being supplanted by sequencing techniques on account of efficiency and accuracy. These days, SSCP is most applicable as a diagnostic tool in molecular biology. It can be used in genotyping to detect homozygous individuals of different allelic states, as well as heterozygous individuals that should each demonstrate distinct patterns in an electrophoresis experiment. SSCP is also widely used in virology to detect variations in different ... and E. W. Kitajima. Evaluation of the genetic variability of orchid fleck virus by single strand conformational polymorphism analysis and nucleotide sequencing of a fragment from the nucleocapsid ... Societies, 21 May 2009. ref . References references DEFAULTSORT Single Strand Conformation Polymorphism Category Molecular biology Category Gene tests genetics stub de SSCP fr Polymorphisme ... more details
to Guanine G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M405 See also Singlenucleotidepolymorphism Unique event polymorphism Human Y chromosome DNA haplogroup s List of Y STR markers External ...class wikitable Mutation number Nucleotide change Position base pair Total size base pair s Position Forward 5 3 Reverse 5 3 M1 YAP 291bp insertion M2 Adenine A to Guanine G 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc M3 M4 M8 M9 M15 M17 M20 M33 M35 M38 M40 M42 M45 M52 M55 M57 M60 M64.1 M75 M89 M91 M94 M95 M96 M105 M122 M124 M130 M131 M132 M139 M145 M168 M170 M172 M173 M174 M175 M176 M179 M201 M203 M207 M213 M214 M216 M217 M231 Guanine G to Adenine A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg M241 Guanine G to Adenine A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M242 Cytosine C to Thymine T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 Cytosine C to Thymine T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt M258 M267 Thymine T to Guanine G 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M268 M269 M285 Guanine G to Cytosine C 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M286 Guanine G to Adenine A 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M287 Adenine A to Thymine T 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M297 M299 M304 Adenine A to Cytosine C 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt M306 M335 Thymine T to Adenine A 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta M339 Thymine T to Guanine G 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt M340 Guanine G to Cytosine C 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa M342 Cytosine C to Thymine T 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact M343 Cytosine C to Adenine A 402 424 tttaacctcctccagctctgca acccccacatatctccagg M347 M349 Guanine G to Thymine T 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct M356 M359 Thymine T to Cytosine C 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt M365 Adenine A to Guanine G 246 274 ... more details
wiktionary dimorphic dimorphism dimorphous polymorphisms polymorphous Polymorphism or dimorphism may refer to tocright Biology Polymorphism biology , including having multiple phenotype s within a population the switch that determines which phenotype an individual displays can be genetic or environmental includes Sexual dimorphism , differences in the physiology of a species based only on sex having multiple alleles of a gene within a population, usually expressing different phenotypes Lipid polymorphism , the property of amphiphiles that gives rise to various aggregations of lipids Nuclear dimorphism , when a cell s nuclear apparatus is composed of two structurally and functionally differentiated types of nuclei Frond dimorphism , differing forms of fern fronds between the sterile and fertile fronds Computing Polymorphism computer science , allowing program code to work with various types Polymorphism in object oriented programming , the ability of an interface to be realized in multiple ways Dialog polymorphism, changing the form of a computer dialog every time it is presented to a user, in order to prevent habituation Polymorphic code , self modifying program code designed to defeat anti virus programs or to defeat reverse engineers Chemistry Polymorphism materials science , the ability of a solid material to exist in more than one form or crystal structure Medicine A type of QRS complex seen on an electrocardiogram Psychology Polymorphous perversity , a concept in psychoanalytic theory See also Polymorph disambiguation Monomorphic disambiguation disambiguation bs Polimorfizam vor ca Polimorfisme de Polymorphie et Pol morfism es Polimorfismo fr Polymorphisme it Polimorfismo lt Polimorfizmas reik m s nl Polymorfisme pl Polimorfizm pt Polimorfismo desambigua o ru sr sv Polymorfism ta uk zh ... more details
unit Nucleotide abbreviated nt is a common length unit for single stranded RNA , similar to how base ... sup sup . Nucleotide derivatives such as the nucleoside triphosphate s play central roles in metabolism .... ref Image Nucleotides 1.svg thumb 600px Structural elements of the most common nucleotides Nucleotide ... A nucleotide is composed of a nucleobase nitrogenous base , a five carbon sugar either ribose or deoxyribose ... with either the 2, 3, or 5 carbon of the sugar, with the 5 carbon site most common. Cyclic nucleotide ... base. Nucleic acid s are polymeric macromolecules made from nucleotide monomers. In DNA , the purine ... de novo synthesis de novo or recycled through nucleotide salvage salvage pathways . ref cite journal ..., RL. title Contribution of de novo and salvage synthesis to the uracil nucleotide pool in mouse ... ref The components used in de novo nucleotide synthesis are derived from biosynthetic precursors of carbohydrate ... title Pyrimidine nucleotide biosynthesis in animals Genes, enzymes, and regulation of UMP biosynthesis ... to the branch point intermediate Inosine monophosphate IMP , the nucleotide of the base hypoxanthine ... nucleotide biosynthesis , PPAT catalyzes the displacement of PRPP s pyrophosphate group PP sub i ... 5 PRA and establishing the anomeric form of the future nucleotide. Next, a glycine is incorporated ... blueprint.htm IUPAC nucleotide code ref Apart from the five A, G, C, T U bases, often degenerate bases are used especially for designing Primer molecular biology PCR primers . These nucleotide codes are listed here. class wikitable IUPAC nucleotide code Base Adenine A Adenine Cytosine C Cytosine ... 2004 IUPAC http dl.clackamas.cc.or.us ch106 09 nucleoti.htm Chemistry explanation of nucleotide structure ... fr Nucl otide gl Nucle tido ko hr Nukleotidi id Nukleotida is Kirni it Nucleotide he ... hu Nukleotid mk ms Nukleotida nl Nucleotide ja no Nukleotid oc Nucleotid pl Nukleotydy pt Nucle tido ro Nucleotid ru sq Nukleotidi simple Nucleotide sk Nukleotid sl ... more details
, a value is decided for a . Following Christopher Strachey , parametric polymorphism may be contrasted with ad hoc polymorphism , also called function overloading , in which a single polymorphic ...In programming language s and type theory , parametric polymorphism is a way to make a language more expressive, while still maintaining full static type safety . Using parametric polymorphism computer science polymorphism , a function or a data type can be written generically so that it can handle values ... of argument s to which it is applied. Thus, ad hoc polymorphism can generally only support a limited ... type. History Parametric polymorphism was first introduced to programming languages in ML programming ... generics for parametric polymorphism. Some implementations of type polymorphism are superficially similar to parametric polymorphism while also introducing ad hoc aspects. One example is C template specialization . The most general form of polymorphism is higher rank impredicative polymorphism . Two popular restrictions of this form are restricted rank polymorphism for example, rank 1 or prenex polymorphism and predicative polymorphism. Together, these restrictions give predicative prenex polymorphism , which is essentially the form of polymorphism found in ML and early versions of Haskell. Higher ranked polymorphism Rank 1 prenex polymorphism In a prenex polymorphic system, type variables ... or Let polymorphism technically ML s Let polymorphism has a few other syntactic restrictions . This restriction ... with elements of any type even to lists of polymorphic functions such as code append code itself. Polymorphism ... k polymorphism For some fixed value k , rank k polymorphism is a system in which a quantifier may not appear ... for rank 2 polymorphism is decidable, but reconstruction for rank 3 and above is not. ref name bjpierce Rank n higher rank polymorphism Rank n polymorphism is polymorphism in which quantifiers may appear to the left of arbitrarily many arrows. Predicativity and impredicativity Predicative polymorphism ... more details
in the genotype , such as singlenucleotidepolymorphism SNPs see also RFLP s . This usage is not discussed in this article. Terminology Although in general use polymorphism is quite a broad term ... rate for a single allele . ref name Sheppard 1975 rp ch. 5 Nomenclature Polymorphism crosses several ... supposed. The origin of supergenes Although a polymorphism can be controlled by alleles at a single ... Dark morph or melanistic Jaguar about 6 of the South American population Polymorphism ref Classical ... Ford unk. E.B. Ford Ford E.B. 1965. Genetic polymorphism . Faber & Faber, London. ref Polymorphism is common ... mimicry , and human haemoglobin and blood types . Polymorphism results from evolutionary processes ... which morph is shown is environmental. In genetic polymorphism , the genetic make up determines the morph. Ants exhibit both types in a single population. ref name Clark 1976 cite journal last Clark first W. C. year 1976 title The Environment and the Genotype in Polymorphism journal Zoological ... issue 3 ref ref name Ford 1975 Polymorphism as described here involves morphs of the phenotype ... such as weight , even though this has a heritable component. Polymorphism deals with forms in which ... 4th ed. London Hutchinson. ref The use of the words morph or polymorphism for what is a visibly different ... is in that it may lead to allopatric speciation , whereas true polymorphism takes place in panmictic .... To qualify as a polymorphism there has to be some kind of balance between morphs underpinned .... year 1940 title The New Systematics chapter Polymorphism and Taxonomy editor Julian Huxley ed. publisher ... accurate than polymorphism , but is not often used. It was the preferred term of the evolutionary ... polymorphism usually persists over many generations, maintained by two or more opposed and powerful ... that this kind of polymorphism is quite ancient, at least as far back as the last common ancestor ... cite journal last Stimson first John coauthors Mark Berman year 1990 title Predator induced colour polymorphism ... more details
merge Lepidoptera discuss Talk Polymorphism in Lepidoptera Merger proposal date February 2011 Many types of polymorphism biology polymorphism can be seen in the insect order biology order Lepidoptera . Polymorphism is appearance of forms or morphs differing in colour and number of attributes within a single ... title Genetic polymorphism publisher Oxford University Press page 11 ref In Lepidoptera, polymorphism ... , between geographically separated populations in geographical polymorphism and also between generations flying at different seasons of the year seasonal polymorphism . It also includes the phenomenon ... species. Polymorphism occurs both at specific level with heritable variation in the overall morphological ... within a species. ref name cgillott Genetic polymorphism File Callimorpha.dominula.jpg thumb Scarlet ... morhps and one heterozygous morph. Genetic polymorphism occurs when the morphs are a result of genetic determination only. The extreme case of genetic polymorphism is that of the Papilionidae papilionid ... basis for Polymorphism biology polymorphism and Batesian mimicry . ref cite journal author ... 1971, chapter 7. ref In this instance the genetics appears to be simple two alleles at a single locus ... do not suggest any heterozygous advantage. It was Sheppard who found that the polymorphism is maintained ... gene in the moth Panaxia dominula and the maintenance of polymorphism journal Heredity journal ... cite book author Gullan & Cranston year 2005 chapter Polymorphism and polyphenism pages 163 164 ref ... January 19, 2010 publisher Iowa State University ref Geographical polymorphism Geographical polymorphism ... polymorphism is the Apollo butterfly Apollo butterfly Parnassius apollo . Due to the Apollos ... and software package Lysandra . Minsk, Kiev, Moscow 2005. In Russian ref Environmental polymorphism ... Wet season form Environmental polymorphism, where genetic heritability plays no role, is often .... Genetic polymorphism and natural selection give rise to otherwise edible species the mimic ... more details
In genetics , chromosomal polymorphism is a condition where one species contains members with varying chromosome counts or shapes. Polymorphism biology Polymorphism is a general concept in biology where more than one version of a trait is present in a population. In some cases of differing counts, the difference in chromosome counts is the result of a single chromosome undergoing fission, where it splits into two smaller chromosomes, or two undergoing fusion, where two chromosomes join to form one. This condition has been detected in many species. Trichomycterus davisi , for example, is an extreme case where the polymorphism was present within a single Chimera genetics chimeric individual. ref cite journal journal Genet. Mol. Biol. volume 23 issue 3 month September year 2000 doi 10.1590 S1415 47572000000300018 title Intra individual numerical chromosomal polymorphism in Trichomycterus davisi Siluriformes, Trichomycteridae from the Igua u River basin in Brazil first Luciana Andreia last Borin coauthors Isabel Cristina Martins Santos url http www.scielo.br scielo.php?pid S1415 47572000000300018&script sci arttext&tlng en accessdate 2006 12 08 ref It has also been studied in alfalfa , ref cite journal doi 10.2135 cropsci2002.1291 url http crop.scijournals.org cgi reprint 42 4 1291 title Chromosomal Polymorphism as Detected by C Banding Patterns in Chilean Alfalfa Germplasm first Gary R. last Bauchan, coauthors T. Austin Campbell, and M. Azhar Hossain journal Crop Sci. volume 42 pages 1291 7 date 1 July 2002 issue 4 ref shrew s, ref cite journal author Elrod DA, Beck ML, Kennedy ML title Chromosomal variation in the southern short tailed shrew Blarina carolinensis journal Genetica ... Brazilian rodents, ref cite journal author Thales Renato O. de Freitas title Chromosome polymorphism ... forms of chromosomal polymorphism can be viewed as a step towards speciation . Polymorphisms will generally ... DEFAULTSORT Chromosomal Polymorphism Category Classical genetics ... more details
Image PCWmice1.jpg thumb right Genes which control hair colour are polymorphic. A gene is said to be polymorphic if more than one allele occupies that gene s Locus genetics locus within a population. ref http www.biology online.org dictionary Genetic polymorphism ref Examples of polymorphic genes DRD2 ANKK1 COMT MAOA References reflist Category Genetics ... more details
Polymorphism In programming language theory , subtyping or subtype polymorphism is a form of type polymorphism in which a subtype is a datatype that is related to another datatype the supertype by some notion of substitutability , meaning that program constructs, typically subroutines or functions, written to operate on elements of the supertype can also operate on elements of the subtype. If S is a subtype of T, the subtyping binary relation relation is often written S T, to mean that any term of type S can be safely used in a context where a term of type T is expected. The precise semantics of subtyping ... a term to have belong to more than one type, subtyping is a form of type polymorphism , so it is properly called subtype polymorphism. In object oriented programming subtyping is commonly called just polymorphism see polymorphism in object oriented programming . Subtyping is practically never called this way in type theory or in functional programming , where the unqualified use of polymorphism usually refers to parametric polymorphism , as in polymorphic lambda calculus . Mechanisms similar in purpose, but not identical with parametric polymorphism are known by other names in object oriented ... also provide some, usually restricted, form of parametric polymorphism. In a theoretical setting, it is desirable ... has gained visibility and synonymy with polymorphism in some circles with the mainstream adoption ... Bounded Polymorphism . Subtyping in type theory is characterized by the fact that any expression of type ... can be defined in System F sub System F sub sub , which combines parametric polymorphism with subtyping ... languages. See also wikibooks Ada Programming Type System Subtypes Polymorphism in object oriented ... vs. structural types and subtyping , and 23.2 varieties of polymorphism C. Szyperski, D. Gruntz, S. Murer ... of records and objects. refend data types DEFAULTSORT Subtype Polymorphism Category Data types Category Polymorphism computer science Category Type theory Category Object oriented programming bn ... more details
Nucleotide diversity is a concept in molecular genetics which is used to measure the degree of polymorphism biology polymorphism within a population. ref cite journal title Mathematical Model for Studying Genetic Variation in Terms of Restriction Endonucleases journal PNAS date October 1, 1979 first last coauthors Masatoshi Nei and Wen Hsiung Li volume 76 issue 10 pages 5269 73 pmid 291943 pmc 413122 url doi 10.1073 pnas.76.10.5269 author Nei, M. ref One commonly used measure of nucleotide diversity was first introduced by Nei and Li in 1979. This measure is defined as the average number of nucleotide differences per site between any two DNA sequences chosen randomly from the sample population, and is denoted by . It is given by the formula math pi sum ij x i x j pi ij 2 sum i 1 n sum j 1 i 1 x i x j pi ij math where x sub i sub and x sub j sub are the respective frequencies of the i th and j th sequences, sub ij sub is the number of nucleotide differences per nucleotide site between the i th and j th sequences, and n is the number of sequences in the sample. Nucleotide diversity ... Length Polymorphism AFLP data. ref cite journal title A method for estimating nucleotide diversity ... DnaSP &mdash DNA Sequence Polymorphism, is a software package for the analysis of nucleotidepolymorphism ... lines reveal no reduction of nucleotide diversity during Triticum monococcum Einkorn domestication ... evolutionary relationships. ref cite journal title Nucleotide diversity in gorillas journal Genetics ... cgi pmidlookup?view long&pmid 15082556 author Yu, N. ref Nucleotide diversity can be calculated ... Amplified Polymorphic DNA RAPD data ref cite journal title Estimating nucleotide diversity from random amplified polymorphic DNA and amplified fragment length polymorphism data journal Molecular ... of nucleotide diversity and a variety of other statistical tests for intra population and inter ... Reflist DEFAULTSORT Nucleotide Diversity Category Molecular genetics genetics stub ar ... more details
Image Cyclic adenosine monophosphate 2D skeletal.png thumb Cyclic adenosine monophosphate Image CGMP.png thumb Cyclic guanosine monophosphate A cyclic nucleotide is any nucleotide in which the phosphate group is bonded to two of the sugar s hydroxyl groups, forming a cyclical or ring structure. These include cyclic AMP cyclic GMP cyclic ADP ribose These function as second messenger s associated with G protein s and calcium signaling . External links MeshName Nucleotides, Cyclic Nucleobases, nucleosides, and nucleotides Category Nucleotides Biochem stub et Ts klilised nukleotiidid nl Cyclisch nucleotide no Syklisk nukleotid sr Cikli ni nukleotid ... more details
enzyme Name nucleotide diphosphokinase EC number 2.7.6.4 CAS number 53167 92 3 IUBMB EC number 2 7 6 4 GO code 0050148 image width caption In enzymology , a nucleotide diphosphokinase EC number 2.7.6.4 is an enzyme that catalysis catalyzes the chemical reaction ATP nucleoside 5 phosphate math rightleftharpoons math AMP 5 phosphonucleoside 3 diphosphate Thus, the two substrate biochemistry substrates of this enzyme are adenosine triphosphate ATP and nucleoside 5 phosphate , whereas its two product chemistry products are adenosine monophosphate AMP and 5 phosphonucleoside 3 diphosphate . This enzyme belongs to the family of transferase s, specifically those transferring two phosphorus containing groups diphosphotransferase s . The systematic name of this enzyme class is ATP nucleoside 5 phosphate diphosphotransferase . Other names in common use include nucleotide pyrophosphokinase , ATP nucleotide pyrophosphotransferase , ATP nucleotide 3 pyrophosphokinase , and nucleotide 3 pyrophosphokinase . References reflist 1 cite journal author Murao S and Nishino T date 1974 title Isolation and identification of ATP nucleotide pyrophosphotransferase producing microorganism journal Agric. Biol. Chem. volume 38 pages 2483&ndash 2489 doi 10.1271 bbb1961.38.2483 issue 12 cite journal author Nishino T and Murao S date 1974 title Purification and some properties of ATP nucleotide pyrophosphotransferase of Streptomyces adephospholyticus journal Agric. Biol. Chem. volume 38 pages 2491&ndash 2496 doi 10.1271 bbb1961.38.2491 issue 12 cite journal author Nishino T and Murao S date 1975 title Characterization of pyrophosphoryl transfer reaction of ATP nucleotide pyrophosphotransferase journal Agric. Biol. Chem. volume 39 pages 1007&ndash 1014 doi 10.1271 bbb1961.39.1007 issue 5 enzyme stub Category EC 2.7.6 Category Enzymes of unknown structure ... more details
enzyme Name nucleotide diphosphatase EC number 3.6.1.9 CAS number 9032 64 8 IUBMB EC number 3 6 1 9 GO code 0004551 image width caption In enzymology , a nucleotide diphosphatase EC number 3.6.1.9 is an enzyme that catalysis catalyzes the chemical reaction a dinucleotide H sub 2 sub O math rightleftharpoons math 2 mononucleotides Thus, the two substrate biochemistry substrates of this enzyme are dinucleotide and water H sub 2 sub O , whereas its product chemistry product is Nucleotide mononucleotide . This enzyme belongs to the family of hydrolase s, specifically those acting on acid anhydrides in phosphorus containing anhydrides. The systematic name of this enzyme class is dinucleotide nucleotidohydrolase . Other names in common use include nucleotide pyrophosphatase , and nucleotide sugar pyrophosphatase . This enzyme participates in 5 metabolism metabolic pathways purine metabolism , starch and sucrose metabolism , riboflavin metabolism , nicotinate and nicotinamide metabolism , and pantothenate and coa biosynthesis . Structural studies As of 2007 alt As of late 2007 , 5 tertiary structure structures have been solved for this class of enzymes, with Protein Data Bank PDB accession codes PDB link 1NQY , PDB link 1NQZ , PDB link 2GSN , PDB link 2GSO , and PDB link 2GSU . References reflist 1 cite journal author Jacobson JB and Kaplan NO date 1957 title A reduced pyridine nucleotide pyrophosphatase journal J. Biol. Chem. volume 226 pages 427&ndash 437 pmid 13428775 cite journal author Kornberg A and Pricer WE date 1950 title Nucleotide pyrophosphatase journal J. Biol. Chem. volume 182 pages 763&ndash 778 cite journal author Kumar SA, Rao NA, Vaidyanathan CS date 1965 title Nucleotidases in plants. I. Partial purification and properties of the enzyme hydrolyzing flavine adenine dinucleotide from mung bean seedlings Phaseolus radiatus journal Arch. Biochem. Biophys. volume ... MN, Kaplan NO and Lamborg MF date 1958 title A heat activated diphosphopyridine nucleotide pyrophosphatase ... more details
Nucleotide sugars are the activated forms of monosaccharides . Nucleotide sugars act as glycosyl donors in glycosylation reactions. Those reactions are catalyzed by a group of enzymes called glycosyltransferase s. History The anabolism of oligosaccharides and, hence, the role of nucleotide sugars was not clear until 1950s when Leloir and his coworkers found that the key enzymes in this process are the glycosyltranserases. These enzymes transfer a glycosyl group from a sugar nucleotide to an acceptor. ref cite journal author Derek Horton title The Development of Carbohydrate Chemistry and Biology journal Carbohydrate Chemistry, Biology and Medical Applications pages 1 28 year 2008 doi 10.1016 B978 0 08 054816 6.00001 X isbn 9780080548166 ref Biological Importance To act as glycosyl donors, those monosaccharides should exist in a highly energetic form. This occurs as a result of a reaction between nucleoside triphosphate NTP and glycosyl monophosphate phosphate at anomeric carbon . Image activatedmonosaccahride.png frameless center 600px Activation of Monosaccharides Types There are nine sugar nucleotides in complex animals which act as glycosyl donors and they can be classified depending on the type of the nucleoside forming them ref http www.cshlpress.com default.tpl?action full& eqskudatarq ... Diphosphate GDP mannose GDP Man , GDP Fuc. Cytosine Monophosphate CMP Neu5Ac , it is the only nucleotide sugar in the form of nucleotide monophosphate. In plants and bacteria many other sugars are used ... in nucleotide sugar precursor synthesis and O antigen assembly journal Carbohydr. Res. volume 338 ... of some nucleotide sugars example from each type . class wikitable border 1 style text align center ... GDP Man Relationship between glycosylation pathways and different diseases Normal metabolism of nucleotide ... feeding problems. See also Nucleotide sugars metabolism Carbohydrate chemistry Glycosyltransferase References reflist External links MeshName Nucleotide sugars Nucleotide sugars Category Metabolism Category ... more details
A salvage pathway is a Metabolic pathway pathway in which nucleotide s purine and pyrimidine are synthesized from intermediates in the degradative pathway for nucleotides. Salvage pathways are used to recover bases and nucleosides that are formed during biodegradation degradation of RNA and DNA . This is important in some organs because some tissues cannot undergo de novo synthesis . The salvaged bases and nucleosides can then be converted back into nucleotides. Substrates The salvage pathway requires distinct substrates Pyrimidines Uridine phosphorylase adds ribose 1 phospate to the free base uracil, forming uridine monophosphate. Uridine kinase then phosphorylates this nucleoside into its diphosphate and triphosphate forms. Deoxythymidine phosphorylase adds deoxyribose 1 phosphate to thymine, forming deoxythymidine monophosphate. Thymidine kinase can then phosphorylate this compound to deoxythymidine diphosphate and triphosphate. Image Pyrimidine Ribonucleotide Salvage.png thumb none 400px The salvage of pyrimidine ribonucleotides. Purines Phosphoribosyltransferases add activated ribose 5 phosphate called phosphoribosyl pyrophosphate or PRPP to bases, creating nucleotide monophosphates. There are two types of phosphoribosyltransferases adenine phosphoribosyltransferase APRT and hypoxanthine guanine phosphoribosyltransferase HGPRT . Lesch Nyhan syndrome is associated with a deficiency of HGPRT. class wikitable Nucleoside Enzyme Nucleotide hypoxanthine hypoxanthine guanine phosphoribosyl transferase HGPRT Inosine monophosphate IMP guanine hypoxanthine guanine phosphoribosyl transferase HGPRT Guanosine monophosphate GMP adenine adenine phosphoribosyltransferase APRT Adenosine monophosphate AMP External links http www.chem.brandeis.edu pochapsky research.html Enzymes in the methionine salvage pathway structure and function at Brandeis University Category Genetics genetics stub Protein metabolism Nucleotide metabolism ca Salvament de nucle tids de Salvage Pathway ja ... more details
Unreferenced date November 2006 Image Aminoallyl Uridine.svg right frame The structure of aminoallyluridine Aminoallyl nucleotides are used in post labeling of nucleic acid s to be used in microarray s. These nucleotides are formally known as 5 3 amino allyl nucleotides since the aminoallyl group is usually attached to carbon 5 of the pyrimidine ring of uracil and cytosine . They are usually abbreviated as aa , such as aa dUTP. The amine group in the aminoallyl moiety is aliphatic and thus more reactive compared to the amine groups that are directly attached to the rings aromatic of the bases. Uses The aminoallyl group in aminoallyl modified nucleotides is reactive with dyes such as the cyanine series, AnaSpec HiLyte Fluor , or Alexa Fluor dyes that also been modified to be amine reactive. A problem with this method is that the dyes react with the buffering agent usually used for storage of nucleotides. Instead a carbonate buffer is used. The DNA or RNA from a sample is copied in vitro by T7 polymerase, RT polymerase or some other polymerase except of eukaryotic origin in a mix of nucleotides in which one, typically uracil RNA and also DNA , is a mix aminoallyl NTP and normal UTP. An alternative method is using thiol reactive dyes. DEFAULTSORT Aminoallyl Nucleotide Category Nucleic acids Category Nucleotides molecular cell biology stub ... more details
from J2a in Y DNA haplogroup Haplogroup J Y DNA J . See also Haplogroup Singlenucleotidepolymorphism ...In genetic genealogy a unique event polymorphism UEP is a genetic marker that corresponds to a mutation which is likely to occur so infrequently that it is believed overwhelmingly probable that all the individuals who share the marker, worldwide, will have inherited it from the same common ancestor, and the same single mutation event. Generally, UEP is an allele for which all copies derive from a single mutation al event. ref cite book ISBN 978 087969684 9 ref In genetic genealogy the mutations considered to be UEPs can be any germline mutation usually singlenucleotidepolymorphism s &ndash the replacement of one letter by another in the DNA sequence, and the terms UEP and SNP are often loosely used interchangeably. But UEPs may also be large scale additions, such as the YAP genetics YAP insertion which defines Y DNA haplogroups haplogroup D Y DNA D and haplogroup E Y DNA E , inversion or deletions. The discovery and widespread testing of new UEPs has been the key to the increasingly detailed analysis of the patrilineal and matrilineal ancestry of mankind into ever more precise family trees of Y DNA , mtDNA haplogroup s. UEPs in X chromosome X and autosome autosomal chromosomes are also used to trace genealogy extending time ranges available for Y DNA and mtDNA. ref cite doi 10.1038 nrg1941 ref Comparison with short tandem repeats STRs The properties of UEPs can be contrasted with those of short tandem repeat sequences STRs , the other main type of genetic variation made use of in genealogical DNA test ing. Unlike UEPs, STR sequences are highly variable, and there is a significant probability that one of a set may have changed its repeat number after only a few generations. That makes a particular STR haplotype much more specific, matching a much smaller number of people ... than the usual single increment or decrement, which can be considered to have been a unique one ... more details
until the time of invocation, and single dispatch i.e., single argument polymorphism , because ...merge from Polymorphism in object oriented programming date April 2011 expert subject Computer science ... programming Polymorphism in object oriented programming Polymorphism In computer science , polymorphism ... using a uniform interface. The concept of parametric polymorphism applies to both data types and function ... kinds of polymorphism, two of which were originally informally described by Christopher Strachey ... on a limited range of individually specified types and combination, it is called ad hoc polymorphism . Ad hoc polymorphism is supported in many languages using function overloading function and method ... with any number of new types, it is called parametric polymorphism . John C. Reynolds and later Jean Yves Girard formally developed this notion of polymorphism as an extension to lambda calculus ... polymorphism is widely supported in static typing statically typed functional programming language s. In the object oriented programming community, programming using parametric polymorphism is often called generic programming . In object oriented programming , subtype polymorphism or inclusion polymorphism ... Analysis and Design with Applications. Addison Wesley. ref Inclusion polymorphism is generally ..., inclusion polymorphism may be achieved through type coercion , also known as type casting. Interaction between parametric polymorphism and subtyping leads to the concepts of bounded quantification and covariance ... s. History Empty section date March 2011 Forms of polymorphism Ad hoc polymorphism main Ad hoc polymorphism Chris Strachey ref C. Strachey, Fundamental concepts in programming languages. Lecture ... the term ad hoc polymorphism to refer to polymorphic functions which can be applied to arguments ... is not intended to be pejorative it refers simply to the fact that this type of polymorphism is not a fundamental ... only be determinable at run time. Parametric polymorphism main Parametric polymorphism Parametric ... more details
of many singlenucleotidepolymorphism s SNPs in that project as well as the direct ...In molecular biology , restriction fragment length polymorphism , or RFLP commonly pronounced rif lip , is a technique that exploits variations in homologous DNA sequences. It refers to a polymorphism biology difference between samples of homologous DNA molecules that come from differing locations of restriction site restriction enzyme sites , and to a related laboratory technique by which these segments can be illustrated. In RFLP analysis , the DNA sample is broken into pieces digested by restriction enzymes and the resulting restriction fragments are separated according to their lengths by gel electrophoresis . Although now largely obsolete due to the rise of inexpensive DNA sequencing technologies, RFLP analysis was the first DNA profiling technique inexpensive enough to see widespread application. In addition to genetic fingerprinting , RFLP was an important tool in genome mapping , localization of genes for genetic disorder s, determination of Genetic testing risk for disease, and paternity testing . Analysis technique The basic technique for detecting RFLPs involves fragmenting a sample of DNA by a restriction enzyme , which can recognize and cut DNA wherever a recognition sequence specific short base pairs sequence occurs, in a process known as a restriction digest . The resulting DNA fragments are then separated by length through a process known as agarose gel electrophoresis , and transferred to a membrane via the Southern blot procedure. Nucleic acid hybridization Hybridization of the membrane to a labeled Hybridization probe DNA probe then determines the length of the fragments ... an allele , and can be used in Genetics genetic analysis . RFLP analysis may be subdivided into single ... a technique used in marker assisted selection. Terminal restriction fragment length polymorphism TRFLP ... references DEFAULTSORT Restriction Fragment Length Polymorphism Category Genomics ar ... more details
In programming languages , ad hoc polymorphism ref C. Strachey, Fundamental concepts in programming languages. Lecture notes for International Summer School in Computer Programming, Copenhagen, August 1967 ref is a kind of polymorphism computer science polymorphism in which polymorphic functions can ... is not intended to be pejorative it refers simply to the fact that this type of polymorphism is not a fundamental feature of the type system. This is in contrast to parametric polymorphism ... a single abstract implementation to any number of types in a transparent way. This classification ... polymorphism is a Dynamic dispatch dispatch mechanism control moving through one named function is dispatched ... being appended. This differs from parametric polymorphism, in which the function would need to be written ... with parametric polymorphism. Another way to look at overloading is that a routine is uniquely ... parameters. This type of polymorphism is common in object oriented programming languages, many of which ... overloading . Some languages which are not dynamically typed and lack ad hoc polymorphism including ... is done at compile time, it is not a substitute for late binding as found in Subtyping polymorphism subtyping polymorphism . Late binding The previous section notwithstanding, there are other ways in which ad hoc polymorphism can work out. Consider for example the Smalltalk language. In Smalltalk ... time, after the program is compiled. Therefore, polymorphism is given by Subtyping polymorphism subtyping polymorphism as in other languages, and it is also extended in functionality by ad hoc polymorphism ... of ad hoc polymorphism. Since Smalltalk has a late bound execution model, and since it provides ... functionality using polymorphism without explicitly overloading a particular message. This may ... polymorphism, there are more uniform languages in which classes are regular objects ..., for an operation, as well as differing implementations. References references Category Polymorphism ... more details
Polymorphism in materials science is the ability of a solid material to exist in more than one form or crystal structure. Polymorphism can potentially be found in any crystalline material including polymer ... morphology of a material is described by polymorphism and other variables such as crystal habit , Amorphous solid amorphous fraction or crystallographic defect s. Polymorphism is relevant to the fields ... polymorphism exists as a result of difference in crystal packing, it is called packing polymorphism . Polymorphism can also result from the existence of different conformer s of the same molecule in conformational polymorphism . In pseudopolymorphism the different crystal types are the result of Mineral ... types of polymorphism. For a monotropic system, a plot of the free energy of the various polymorphs ... of polymorphism in organic materials is attributed to Friedrich W hler and Justus von Liebig when ... Polymorphism in Benzamide Solving a 175 Year Old Riddle Juergen Thun, Lena Seyfarth, Juergen Senker ... bonds differences leading to conformational polymorphism change in stirring conditions Despite the potential implications, polymorphism is not always well understood. In 2006 a new crystal ... the latent polymorphism of maleic acid journal Chemical Communications year 2006 volume 1 issue ... author Thallapally PK, Jetti RKR, Katz AK title Polymorphism of 1,3,5 trinitrobenzene induced by a trisindane ... in nature. Polymorphism in pharmaceuticals Polymorphism is important in the development of active ... for only a single crystal form or polymorph. In a classic patent case the pharmaceutical company ... 2011 . Polymorphism in drugs can also have direct medical implications. Medicine is often administered ... in XRPD, it is perfectly feasible to obtain the structure of a polymorph of a drug, even if there is no single ... author Andrew D. Bond, Roland Boese, Gautam R. Desiraju title On the Polymorphism of Aspirin Crystalline ... such as carbon tetrachloride Estrogen and chloroamphenicol also show polymorphism Interesting occurrences ... more details
Disputed date October 2010 merge to Polymorphism computer science date April 2011 Polymorphism Subtype polymorphism , almost universally called just polymorphism in the context of object oriented programming ... derives from the Greek meaning having multiple forms . In principle, polymorphism ... of degeneracy biology degeneracy in biology. The purpose of polymorphism is to implement a style ..., polymorphism usually means that type A somehow derives from type B, or type C implements an interface ... used feature of polymorphism. The primary usage of polymorphism in industry object oriented programming ... will also produce similar results for example, returning values of the same type . Subtype polymorphism ..., Inc. date 2005 isbn 0596009208 ref , that is known instead as ad hoc polymorphism ref name lucac http lucacardelli.name Papers OnUnderstanding.A4.pdf On Understanding Types, Data Abstraction, and Polymorphism ref . Polymorphism is only concerned with the application of specific implementation s to an interface ... method overloading nor method overriding are by themselves implementations of polymorphism. ref ... Missy Meow Mr. Mistoffelees Meow Lassie Woof Woof source Parametric Polymorphism further Parametric polymorphism in type theory Generic programming for a more general concept In computer science, the term polymorphism computer science polymorphism has several different but related meanings one of these, known as parametric polymorphism in type system theory and functional programming language s, is known ... on the language s implementation. C implements parametric polymorphism through templates. The use ... polymorphism is called generics and implemented through type erasure . This design decision was made ... code. C parametric polymorphism is called generics and implemented by Reification computer science reification , making C the only language of the three which supports parametric polymorphism as a first ... also Duck typing Inheritance computer science Polymorphism Polymorphic association Virtual function ... more details