Unreferenced date November 2007 PrecursormRNA pre mRNA is an Post transcriptional modification immature single strand of messenger ribonucleic acid mRNA . pre mRNA is synthesized from a DNA template in the cell nucleus by transcription genetics transcription . Pre mRNA comprises the bulk of heterogeneous nuclear RNA hnRNA . The term hnRNA is often used as a synonym for pre mRNA, although, in the strict sense, hnRNA may include nuclear RNA transcripts that do not end up as cytoplasmic mRNA. Once pre mRNA has been completely processed, it is termed mature messenger RNA , mature mRNA , or simply mRNA . Processing Eukaryote Eukaryotic pre mRNA exists only briefly before it is fully processed into mRNA. Pre mRNAs include two different types of segments, exon s and intron s. Exons are segments that are retained in the final mRNA, whereas introns are removed in a process called splicing genetics splicing , which is performed by the spliceosome except for self splicing introns . Additional Post transcriptional modification processing steps attach modifications to the 5 end 5 and 3 end 3 ends of Eukaryotic pre mRNA. These include a 5 cap of 7 methylguanosine and a poly A tail . In addition, eukaryotic pre mRNAs have their introns spliced out by spliceosomes made up of snRNP small nuclear ribonucleoproteins ref Weaver, Robert F. 2005 . Molecular Biology , p.432 448. McGraw Hill, New York, NY. ISBN 0072846119. ref ref Cite doi 10.1016 j.cell.2009.02.009 ref . When a pre mRNA strand has been properly processed to an mRNA sequence, it is exported out of the nucleus and eventually Translation biology translated into a protein a process accomplished in conjunction with ribosome s. In Prokaryota prokaryotes , the splicing is done either autocatalytically or through endolytic cleavage. Autocatalytic ... biology stub ca Pre mRNA de Pr mRNA fr ARN pr messager it Pre mRNA he Pre mRNA nl Pre mRNA ja MRNA pl Pre mRNA ... more details
wiktionary Precursor or Precursors may refer to A word meaning predecessor Gehrlein Precursor , a glider Precursor chemistry , a compound that participates in the chemical reaction that produces another compound Precursor physics , a phenomenon of wave propagation in dispersive media Earthquake precursor , a diagnostic phenomenon that can occur before an earthquake Precursor bird , a hypothesized genus of fossil birds that was actually composed of fossilized parts of unrelated animals The Precursors video game , a video game from Kiev based developer Deep Shadows LNWR Whale Precursor Class , type of passenger locomotive developed for the London and North Western Railway Precursor , a novel set in the Foreigner universe by C. J. Cherryh Precursors, a fictional race now extinct of ancient beings in the board game Cosmic Encounter Precursors, a fictional alien race in the Star Control video game series Precursors, a fictional race of ancient beings in the video game Jak and Daxter The Precursor Legacy Precursors, a fictional alien race in Galactic Civilizations II Dread Lords video game Precursor , a Half Life 2 Episode Two Modification See also Forerunner disambiguation Herald disambiguation Herald disambig cs Prekurzor fr Pr curseur ... more details
Orphan date February 2009 Unreferenced date November 2007 Missense mRNA molecule s have one or more mutated codon s that yield polypeptide s with an amino acid sequence different from the wild type or naturally occurring polypeptide. Missense mRNA molecules are created when template DNA strands or the mRNA strands themselves undergo a missense mutation in which a amino acid sequence protein coding sequence is mutate d and an altered amino acid sequence is coded for. molecular cell biology stub Category RNA Category Molecular biology ... more details
enzyme Name mRNA guanylyltransferase EC number 2.7.7.50 CAS number 56941 23 2 IUBMB EC number 2 7 7 50 GO code 0004484 image width caption lowercase In enzymology , a mRNA guanylyltransferase EC number 2.7.7.50 is an enzyme that catalysis catalyzes the chemical reaction GTP 5 ppPur mRNA math rightleftharpoons math diphosphate G 5 pppPur mRNA Thus, the two substrate biochemistry substrates of this enzyme are guanosine triphosphate GTP and 5 ppPur mRNA , whereas its two product chemistry products are diphosphate and G 5 pppPur mRNA . This enzyme belongs to the family of transferase s, to be specific those transferring phosphorus containing nucleotide groups nucleotidyltransferase s . The systematic name of this enzyme class is GTP mRNA guanylyltransferase . Other names in common use include mRNA capping enzyme , messenger RNA guanylyltransferase , and Protein 2 . Structural studies As of late 2007, 5 tertiary structure structures have been solved for this class of enzymes, with Protein Data Bank PDB accession codes PDB link 1CKM , PDB link 1CKN , PDB link 1CKO , PDB link 1P16 , and PDB link 2C46 . References reflist 1 cite journal author Ensinger MJ, Martin SA, Paoletti E, Moss B date 1975 title Modification of the 5 terminus of mRNA by soluble guanylyl and methyl transferases from vaccinia virus journal Proc. Natl. Acad. Sci. U. S. A. volume 72 pages 2525&ndash 9 pmid 1058472 doi 10.1073 pnas.72.7.2525 issue 7 pmc 432801 cite journal author Groner Y, Gilboa E, Aviv H date 1978 title Methylation and capping of RNA polymerase II primary transcripts by HeLa nuclear homogenates journal ... Martin SA, Moss B date 1975 title Modification of RNA by mRNA guanylyltransferase and mRNA guanine ... 1194287 issue 24 cite journal author Martin SA, Paoletti E, Moss B date 1975 title Purification of mRNA guanylyltransferase and mRNA guanine 7 methyltransferase from vaccinia virions journal J. Biol. Chem. volume 250 pages 9322&ndash 9 pmid 1194286 issue 24 kinases enzyme stub Category EC 2.7.7 mRNA ... more details
lowercase title mRNA display mRNA display is a display technique used for in vitro protein , and or peptide ... peptides or proteins that are associated with their mRNA progenitor via a puromycin linkage. The complex then binds to an immobilized target in a selection step affinity chromatography . The mRNA ... products. Image Slide10.png thumb 370px Figure 2. mRNA Polypeptide Fusion Formation. a. Ribosome moves along the mRNA template and nascent peptide is being made. When the ribosome reaches the 3 end of the template, the fused puromycin will enter the A site of the ribosome. b. The mRNA polypeptide fusion is released. All mRNA templates used for mRNA display technology have puromycin at their 3 end. As translation proceeds, ribosome moves along the mRNA template, and once it reaches the 3 ... peptide. The mRNA polypeptide fusion is then released from the ribosome Figure 2 . To synthesize an mRNA polypeptide fusion, the fused puromycin is not the only modification to the mRNA template ... end of an mRNA and the puromycin has to be flexible and long enough to allow the puromycin to enter ..., full length mRNA polypeptide fusion. Rihe Liu et al. optimized the 3 puromycin oligonucleotide spacer ... portion of the linker also allows further purification of the mRNA polypeptide fusion due to its high affinity for dT cellulose resin. The mRNA polypeptide fusions can be selected over immobilized selection ... off. Method Image Slide8.png thumb 370px Figure 3. Splint Aid Single Stranded mRNA DNA T4 DNA Ligase Ligation The synthesis of an mRNA display library starts from the synthesis of a DNA library. A DNA ... in vitro T7 transcription to transcribe the DNA library into an mRNA library, which provides templates ... Nova Lysate Novagen , which needs a TMV ribosomal binding site. Once the mRNA library is generated ... at the 3 end. In this ligation step, a piece of mRNA is ligated with a single stranded DNA ... is designed to be complementary to the 3 end of the mRNA, and the 3 terminus of the splint is designed ... more details
Lower case title mRNA surveillance mechanisms are pathways utilized by organisms to ensure fidelity and quality of messenger RNA mRNA molecules. There are a number of surveillance mechanisms present within cells. These mechanisms function at various steps of the mRNA biogenesis pathway to detect and degrade ... transcripts into proteins is a vital part of the central dogma of molecular biology . mRNA molecules are, however, prone to a host of fidelity errors which can cause errors in translation of mRNA into quality proteins ref name Amrani Amrani, N., Sachs, M.S. and Jacobson, A. 2006 Early nonsense mRNA ... are methods cells use to assure the quality and fidelity of the mRNA molecules ref Moore, M.J. ... achieved through marking aberrant mRNA molecule for Chemical decomposition degradation ... mediated mRNA decay, Nature 432 2004 , pp. 112 118. ref . mRNA surveillance has been documented ... control in mRNA biogenesis. Nat. Struct. Mol. Biol. 12, 482 488. ref . Fidelity checks of mRNA ... surveillance mechanisms assess mRNA transcripts for the absence of or presence of premature stop ... within Cell biology cells the Nonsense Mediated mRNA decay pathway NMD the Nonstop Mediated mRNA decay pathways NSD and the No go Mediated mRNA decay pathway NGD . Nonsense Mediated mRNA Decay ... Nonsense Mediated decay is involved in detection and decay of mRNA transcripts which contain premature ... transcriptional mRNA processing ref name jebus Chang, Y.F., Imam, J.S. and Wilkinson, M.F. 2007 The nonsense ..., J., Raes, J. and Izaurralde, E. 2006 Nonsense mediated mRNA decay target genes and functional diversification of effectors. Trend Biochem. Sci. 31, 639 646. ref . Failure to recognize and decay these mRNA ... Maquat Maquat, L.E. 2004 Nonsense mediated mRNA decay splicing, translation and mRNP dynamics. Nat. Mol ... the mRNA for premature stop codons ref name jebus . The assembly of this complex is triggered by premature translation termination. If a premature stop codon is detected then the mRNA transcript is signalled ... more details
for the data structure nested set model Subgenomic mRNA s are essentially smaller sections of the original transcribed template strand . During Transcription genetics transcription , the original template strand is usually read from the 3 to the 5 end from beginning to end. Subgenomic mRNAs are created when transcription begins at the 3 end of the template strand or 5 of the to be newly synthesized template and begins to copy towards the 5 end of the template strand before jumping to the end of the template and copying the 5 end of the template, creating a 3 tail for the newly created strand. As a result, the newly created strand will have similar 5 ends to varying degrees with the original template depending on when the transcription began the jump and similar 3 ends to the template ref Wu B, White KA. Uncoupling RNA virus replication from transcription via the polymerase functional and evolutionary insights. EMBO J. 2007 Nov 22 ref . The result is many different proteins created from the different lengths of mRNA created from the same strand with similar 5 ends to varying degrees and same 3 ends. The similar 5 sections on the newly created strand is a result of the same section being copied from the template strand, and this section on the template strand is referred to as the nested set ref Le TM, Wong HH, Tay FP, Fang S, Keng CT, Tan YJ, Liu DX. Expression, post translational modification and biochemical characterization of proteins encoded by subgenomic mRNA8 of the severe acute respiratory syndrome coronavirus. FEBS J. 2007 Aug 274 16 4211 22. Epub 2007 Jul 20. ref . pre GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACGTTATTTCTGCGCGGAAAAAAAAA Original Strand GCCGCCCCGTATCGATCGTAGCGCACGTTATATATAC AAAAAAAAA GCCGCCCCGTATCGATCGTAGCGCAC AAAAAAAAA Subgenomic mRNA. The s indicate jumps .... Subgenomic mRNA transcription in an aureusvirus Down regulation of transcription and evolution of regulatory ... Journal. 26, 5120 5130 cs Subgenomick mRNA nl Subgenomisch mRNA ... more details
Infobox rfam Name ACAT1 mRNA image ACAT SS.png width caption Conserved secondary structure of ACAT1 mRNA Symbol ACAT1 AltSymbols Rfam RF01495 miRBase miRBase family RNA type Tax domain GO 0006446 SO 0005836 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData Human acetyl coA cholesterol acyltransferase ACAT1 gene produces a chimeric mRNA through the interchromosomal processing of two discontinuous RNA RNAs transcribed from chromosomes 1 and 7. ref name pmid15319423 Cite pmid 15319423 ref This Fusion protein chimeric mRNA uses AUG as a translation genetics translation initiation codon to produce the normal 50 kDa ACAT1 protein but used an alternative translation initiation codon, GGC, to produce the novel enzyme enzymatically active 56 kDa isoform. Mutagenesis and mass spectrometry identified the alternative initiation codon as the start codon for the novel 56 kDa protein and its location was mapped to a region located upstream of the AUG initiation codon. Three stem loop structures have been predicted to surround the GCC initiation codon and are known as SL1 to SL3. Mutations that disrupted these stem loop structures showed that SL1 and SL2 as required for translation initiation from the GGC codon but SL3 has no effect on translation efficiency. Translation initiation from the GGC codon was shown to be is mediated by an internal ribosome entry site IRES which requires SL1 located upstream of the IRES and SL2 located downstream. ref name pmid18542101 Cite pmid 18542101 ref This study also showed that SL3 influences the choice of downstream AUG translation initiation codons that will produce the normal 50 KDa human ACAT1 protein. ref name pmid15253151 Cite pmid 15253151 ref References reflist External links Rfam id RF01495 name ACAT1 Category RNA ... more details
Refimprove date December 2008 Infobox neuron neuron name Precursor Cell image neuron caption neuron location function neurotransmitter morphology afferents efferents NeuroLex Precursor Cell NeuroLexID sao467424240 In Cell biology cytology , a precursor cell , also called a blast cell or simply blast , is a type of partially differentiated, usually Unipotency unipotent cell that has lost most or all of the stem cell multipotency . Usually precursor cells are cells capable of differentiating into one or two closely related final forms. Sometimes precursor cell is used as an alternative term for multipotent stem cells. A blastoma is a type of cancer created by malignancies of precursor cells. In embryology , precursor cells are group of cells that differentiate later into one organ. Cytological types Oligodendrocyte precursor cell Myeloblast Thymocyte Meiocyte Megakaryoblast Promegakaryocyte Melanoblast Lymphoblast Bone marrow precursor cells Normoblast Angioblast endothelial precursor cells Myeloid precursor cells References http www.britannica.com EBchecked topic 474470 precursor cell Precursor cell Britannica Online Encyclopedia External links http www.neuinfo.org nif nifgwt.html?query 22Precursor 20Cell 22 NIF Search Precursor Cell via the Neuroscience Information Framework Stem cells Category Cell biology Category Stem cells Cell biology stub pl kom rka blastyczna ... more details
In chemistry , a precursor is a chemical compound compound that participates in the chemical reaction that produces another compound. In biochemistry , the term precursor is used more specifically to refer to a chemical compound preceding another in a metabolic pathway . See also Chemical synthesis Derivative chemistry Metabolism Project STOP Protein precursor DEA list of chemicals Category Chemical synthesis Category Metabolism bg ca Precursor qu mica cs Prekurzor chemie de Pr kursor es Precursor qu mico eo Prekursoro fr Pr curseur chimie he lt Pirmtakai ar hu Prekurzor nl Precursor ja pt Precursor qu mica ru sk Prekurzor sv Prekursor th uk ... more details
Unreferenced date November 2007 Taxobox name Precursor status fossil fossil range Early Eocene regnum Animal ia phylum Chordata classis Aves subclassis Neornithes superordo Neoaves ordo see text genus Precursor genus authority genus authority subdivision ranks Species subdivision Precursor litorum br Precursor magnus br Precursor parvus small type species type small br but see text Precursor is a controversial prehistoric bird genus from the Early Eocene Verify source date November 2007 original text has unsourced 32 mya which is Late Eocene . It was established based on fossil s found in England , e.g. in the famous London Clay deposits. Three species have been named, but the supposed genus seems to be a chimera paleontology chimera composed from remains of different and quite unrelated Neornithes . At least some of the remains seem to belong to a sort of Psittaciformes psittaciform , of which today various parrot s and cockatoo s exist. Initially, it was even supposed that the fossils belonged to some family biology family that is still extant. By now, it seems more likely however that the psittaciform material of the Precursor paratype belongs into the Pseudasturidae of which Halcyornithidae may be the correct name . These were either basal evolution basal in or immediately outside the Psittaciformes, and looked more like puffbird s in Morphology biology habitus though they were almost certainly not at all closely related to the latter. True parrots probably originated in the approximate region of Australia or perhaps neighboring Antarctica and did not reach Europe until less than 30 million years ago. Unfortunately, it is unknown what the affiliations of the holotype material are. The fact that it was originally perceived to be something similar to a pratincole or courser suggests that the revised taxon Precursor may belong into the Charadriiformes . Certainly the Glareolidae are an ancient lineage, possibly originating more than 60 million years ago. If the charadriimorph ... more details
Other uses Precursor disambiguation A protein precursor , also called a pro protein or pro peptide , is an inactive protein or peptide that can be turned into an active form by posttranslational modification . The name of the precursor for a protein is often prefixed by pro . Examples include proinsulin and proopiomelanocortin . Protein precursors are often used by an organism when the subsequent protein is potentially harmful, but needs to be available on short notice and or in large quantities. Enzyme precursors are called zymogen s or proenzyme s. Examples are enzymes of the digestive tract in humans. Some protein precursors are secreted from the cell. Many of these are synthesized with an N terminal signal peptide that targets them for secretion. Like other proteins that contain a signal peptide, their name is prefixed by pre . They are thus called pre pro proteins or pre pro peptides . ref name cell cite book author Alberts, Bruce title Molecular biology of the cell publisher Garland Science location New York year 2002 isbn 0 8153 3218 1 oclc doi page 760 ref The signal peptide is cleaved off in the endoplasmic reticulum . ref name cell An example is preproinsulin . References reflist Category Proteins protein stub de Pr kursor Proteine fr Pr curseur prot ique it Precursore nl Prote ne precursor ... more details
mode of wave propagation. This non specificity has been confirmed by the observation of precursor patterns ...?id 89648 , X. Ni and R. R. Alfano, Brillouin Precursor Propagation in the THz Region in Lorentz Media ... phenomenon, the amplitude at any distance and time of a precursor wave propagating in one ... type of precursor known as the Sommerfeld precursor . ref name sommerfeld See A. Sommerfeld ... phase approximation can be used to analyze the form of precursor waves without solving the general ... and time math t math , the dominant frequency math omega D math of the precursor is the frequency whose ... x t . math Therefore, one can determine the approximate period of a precursor waveform at a particular ... have a faster group velocity than low frequency ones, so the front of the precursor should ... time, components with lower and lower frequencies arrive, so the period of the precursor ... arrive, the amplitude of the precursor also increases. The particular type of precursor characterized by increasing period and amplitude is known as the high frequency Sommerfeld precursor . In a region ... ones, the opposite of the above situation occurs the onset of the precursor is characterized by a long period, and the period of the signal decreases with time. This type of precursor is called a low frequency Sommerfeld precursor . In certain situations of wave propagation for instance, fluid ... that for certain values of time and distance, the precursor waveform will consist of a superposition ... to single frequencies, so at these points there will be a contribution from a precursor signal with a constant period this is known as a Brillouin precursor . References references Category Radiation ... more details
. ref name SoaringNov83 ref name FAAReg The Precursor is of all metal construction and features a fixed monowheel landing gear, with a small tail caster. Only one Precursor was built. ref name SoaringNov83 Operational history PIlot reports indicate that the Precursor climbs well in thermals and exhibits ... . ref name SoaringNov83 ref name FAAReg Specifications Precursor Aircraft specs ref Soaring ref ... more details
Orphan date December 2007 Automatically added by User SoxBot. If this is an error, please contact User Soxred93 C myc mRNA is a type of Messenger RNA mRNA that serves as a template for the Myc MYC protein which is implicated in the rapid growth of cancer cancer cells . This mRNA is a topic of ongoing research to investigate the viability of preventing cancer growth by cleaving or degrading the c myc mRNA. ref cite journal last Lee first Chow H. authorlink Chow H. Lee coauthors Dan Sparanese title CRD BP shields c myc and MDR 1 RNA from endonucleolytic attack by a mammalian endoribonuclease journal ScienceDirect volume 35 issue 4 pages 1209 1221 date 31 January 2007 doi 10.1093 nar gkl1148 pmid 17264115 pmc 1851641 ref References references Category RNA Category Molecular biology ... more details
enzyme Name mRNA nucleoside 2 O methyltransferase EC number 2.1.1.57 CAS number 61970 02 3 IUBMB EC number 2 1 1 57 GO code 0004483 image width caption lowercase In enzymology , a mRNA nucleoside 2 O methyltransferase EC number 2.1.1.57 is an enzyme that catalysis catalyzes the chemical reaction S adenosyl L methionine m sub 7 sub G 5 pppR RNA math rightleftharpoons math S adenosyl L homocysteine m sub 7 sub G 5 pppRm RNA mRNA containing a 2 O methylpurine cap Thus, the two substrate biochemistry substrates of this enzyme are S Adenosyl methionine S adenosyl methionine and m7G 5 pppR RNA , whereas its two product chemistry products are S adenosylhomocysteine and m7G 5 pppRm RNA mRNA containing a 2 O methylpurine cap . This enzyme belongs to the family of transferase s, specifically those transferring one carbon group methyltransferases. The systematic name of this enzyme class is S adenosyl L methionine mRNA nucleoside 2 O methyltransferase . Other names in common use include messenger ribonucleate nucleoside 2 methyltransferase , and messenger RNA nucleoside 2 methyltransferase . Structural studies As of late 2007, two tertiary structure structures have been solved for this class of enzymes, with Protein Data Bank PDB accession codes PDB link 2GA9 and PDB link 2GAF . References reflist 1 cite journal author Barbosa E, Moss B date 1978 title mRNA nucleoside 2 methyltransferase from vaccinia virus Purification and physical properties journal J. Biol. Chem. volume 253 pages 7692&ndash 7 pmid 701281 issue 21 cite journal author Barbosa E, Moss B date 1978 title mRNA nucleoside 2 methyltransferase from vaccinia virus Characteristics and substrate specificity journal J. Biol. Chem ..., Moss B date 1977 title Synthesis of mRNA guanylyltransferase and mRNA methyltransferases in cells infected ... terminus of mRNA by soluble guanylyl and methyl transferases from vaccinia virus journal Proc ... Category Enzymes of known structure it MRNA nucleoside 2 O metiltransferasi ... more details
lowercase enzyme Name mRNA guanine N7 methyltransferase EC number 2.1.1.56 CAS number 56941 25 4 IUBMB EC number 2 1 1 56 GO code 0004482 image width caption PBB geneid 8731 In enzymology , a mRNA guanine N7 methyltransferase also known as mRNA cap guanine N7 methyltransferase is an enzyme that catalysis ... S adenosyl L homocysteine m sub 7 sub G 5 pppR RNA mRNA containing an N sub 7 sub methylguanine cap ... one carbon group methyltransferases. In humans, mRNA cap guanine N7 methyltransferase is encoded ..., Shatkin AJ title Human mRNA capping enzyme RNGTT and cap methyltransferase RNMT map to 6q16 and 18p11.22 ... Z, Maldonado E, Shatkin AJ title Recombinant human mRNA cap methyltransferase binds capping enzyme ... L methionine mRNA guanine N7 methyltransferase . Other names in common use include messenger ribonucleate ..., and S adenosyl L methionine mRNA guanine 7 N methyltransferase. See also 7 Methylguanosine ... E, Moss B date 1975 title Modification of the 5 terminus of mRNA by soluble guanylyl and methyl transferases ... issue 6 cite journal author Martin SA, Moss B date 1975 title Modification of RNA by mRNA guanylyltransferase and mRNA guanine 7 methyltransferase from vaccinia virions journal J. Biol. Chem. volume ... 1975 title Purification of mRNA guanylyltransferase and mRNA guanine 7 methyltransferase from vaccinia ... Langberg SR, Moss B title Post transcriptional modifications of mRNA. Purification and characterization ..., Mizumoto K title Cloning and characterization of three human cDNAs encoding mRNA guanine 7 methyltransferase, an mRNA cap methylase journal Biochem. Biophys. Res. Commun. volume 251 issue 1 pages 27 ... Characterization of human, Schizosaccharomyces pombe, and Candida albicans mRNA cap methyltransferases ... journal author Yamada Okabe T title The Candida albicans gene for mRNA 5 cap methyltransferase identification ... cite journal author Shafer B, Chu C, Shatkin AJ title Human mRNA Cap Methyltransferase Alternative ... de MRNA cap Methyltransferase it MRNA guanina N7 metiltransferasi ... more details
rpoS mRNA encodes for the rpoS stress factor, sigma factor sigma E sup E sup , where DsrA RNA DsrA in conjunction with the LSm Sm like RNA binding protein, Hfq promote the translation of this rpoS mRNA . ref name pmid12208995 Cite pmid 12208995 ref The 5 untranslated region UTR of the rpoS mRNA forms a self inhibitory stem loop that shields the Shine Dalgarno sequence shine dalgarno sequence and therefore inhibits translation. The secondary structure of the 5 UTR was predicted by acetylation of ribose 2 hydroxyls with NMIA and by using a secondary structure prediction program, RNAstructure. ref name pmid15783204 Cite pmid 15783204 ref ref name pmid15123812 Cite pmid 15123812 ref DsrA stimulates rpoS translation by binding in the 5 UTR and causes the stem loop to open, exposing the ribosome binding site. Site directed mutagenesis and deletion analysis located an AAYAA motif identified upstream of the stem loop structure which is required for Hfq binding. ref name pmid18658123 Cite pmid 18658123 ref Comparative genomics has shown that this regulatory secondary structure is conserved across several gram negative bacteria species. References reflist molecular cell biology stub Category Cis regulatory RNA elements ... more details
mechanism for changing the mRNA conformation is unknown. ref name Giu10 cspA protein is then produced ... of the RNA binding protein Hfq with cspA mRNA, encoding the major cold shock protein journal J. Bacteriol ... more details
Infobox rfam Name mir 24 microRNA precursor family image RF00178.jpg width caption Predicted secondary structure and sequence conservation of mir 24 Symbol mir 24 AltSymbols Rfam RF00178 miRBase MI0000080 miRBase family MIPF0000041 RNA type Gene MicroRNA miRNA Tax domain Eukaryota GO GO 0035195 GO 0035068 SO SO 0001244 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The miR 24 microRNA precursor is a small non coding RNA molecule that regulates gene expression. microRNA s are transcribed as 70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a mature 22 nucleotide product. In this case the mature sequence comes from the 3 arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. miR 24 has been identified in human and mouse. ref cite journal last Lagos Quintana first M coauthors Rauhut R, Lendeckel W, Tuschl T year 2001 title Identification of novel genes coding for small expressed RNAs journal Science volume 294 pages 853&ndash 858 pmid 11679670 doi 10.1126 science.1064921 issue 5543 ref ref cite journal last Ambros first V year 2001 title microRNAs tiny regulators with great potential journal Cell volume 107 pages 823&ndash 826 pmid 11779458 doi 10.1016 S0092 8674 01 00616 X issue 7 ref Targets of miR 24 Lal et al. suggested that miR 24 suppresses the tumor suppressor p16 INK4a . ref name pmid18365017 cite journal author Lal A, Kim HH, Abdelmohsen K, et al editor1 last Preiss editor1 first Thomas title p16 INK4a translation suppressed by miR 24 journal ... url ref Wang et al. . have shown that miR 24 reduces the mRNA and protein levels of human ALK4 by targeting the 3 untranslated region of mRNA. ref name pmid17906079 cite journal author Wang Q, Huang ... precursor family http microrna.sanger.ac.uk cgi bin sequences mirna summary.pl?fam MIPF0000041 miRBase family MIPF0000041 DEFAULTSORT Mir 24 Microrna Precursor Family Category MicroRNA miRNA precursor ... more details
Infobox rfam Name lin 4 microRNA precursor image RF00052.jpg width caption Predicted secondary structure and sequence conservation of lin 4 Symbol lin 4 AltSymbols Rfam RF00052 miRBase MI0000002 miRBase family MIPF0000303 RNA type Gene MicroRNA miRNA Tax domain Eukaryota GO GO 0035195 GO 0035068 SO SO 0001244 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData Lin 4 is a microRNA miRNA that was identified from a study of developmental timing in Caenorhabditis elegans C. elegans ref cite journal last Rougvie first AE year 2001 title Control of developmental timing in animals journal Nat Rev Genet volume 2 pages 690&ndash 701 pmid 11533718 doi 10.1038 35088566 issue 9 ref , and was later shown to be part of a much larger class of non coding RNA s termed miRNAs ref cite journal last Ambros first V year 2001 title microRNAs tiny regulators with great potential journal Cell volume 107 pages 823&ndash 826 pmid 11779458 doi 10.1016 S0092 8674 01 00616 X issue 7 ref . lin 4 is found on chromosome II in C. elegans and is complementary to sequences in the 3 untranslated region UTR of lin 14 mRNA. lin 4 acts to developmentally repress the accumulation of lin 14 protein ref name pmid10642801 cite journal author Olsen PH, Ambros V title The lin 4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN 14 protein synthesis after the initiation of translation journal Dev. Biol. volume 216 issue 2 pages 671 80 year 1999 pmid 10642801 doi 10.1006 dbio.1999.9523 ref . lin 4 also targets lin 28 and reduces protein expression ref ... 7 and lin 4 miRNAs results in target mRNA degradation journal Cell volume 122 issue 4 pages 553 63 year .... The products are thought to have regulatory roles through complementarity to mRNA. The involvement ... . References references External links Rfam id RF00052 name lin 4 microRNA precursor http microrna.sanger.ac.uk cgi bin sequences mirna entry.pl?acc MI0000002 MirBase entry for lin 4 miRNA precursor ... more details
Infobox rfam Name mir 6 microRNA precursor image RF00143.jpg width caption Predicted secondary structure and sequence conservation of mir 6 Symbol mir 6 AltSymbols Rfam RF00143 miRBase MI0000124 miRBase family MIPF0000119 RNA type Gene MicroRNA miRNA Tax domain Eukaryota GO GO 0035195 GO 0035068 SO SO 0001244 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The mir 6 microRNA precursor appears to be specific to Drosophila species. In Drosophila melanogaster there are three microRNA precursors called dme mir 6 1, dme mir 6 2, dme mir 6 3 that all give rise to identical mature microRNA sequences. Animal miRNAs are transcribed as 70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a 22 nucleotide product. In this case the mature sequence comes from the 3 arm of the precursor. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA. The involvement of Dicer in miRNA processing suggests a relationship with the phenomenon of RNA interference. miRNAs are numbered based on the sequence of the mature RNA. References reflist 1 1 cite journal last Mourelatos first Z coauthors Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G year 2002 title miRNPs a novel class of ribonucleoproteins containing numerous microRNAs journal Genes Dev volume 16 pages 720&ndash 728 pmid 11914277 doi 10.1101 gad.974702 issue 6 pmc 155365 2 cite journal last Ambros first V year 2001 title microRNAs tiny regulators with great potential journal Cell volume 107 pages 823&ndash 826 pmid 11779458 doi 10.1016 S0092 8674 01 00616 X issue 7 External links Rfam id RF00143 name mir 6 microRNA precursor http microrna.sanger.ac.uk cgi bin sequences mirna summary.pl?fam MIPF0000119 miRBase entry for mir 6 related microRNAs Category microRNA miRNA precursor families molecular cell biology ... more details
Infobox rfam Name mir 156 microRNA precursor image RF00073.jpg width caption Predicted secondary structure and sequence conservation of mir 156 Symbol mir 156 AltSymbols Rfam RF00073 miRBase MI0000178 miRBase family MIPF0000008 RNA type Gene MicroRNA miRNA Tax domain Eukaryota GO GO 0035195 GO 0035068 SO SO 0001244 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData MicroRNA miRNA precursor mir 156 is a family of plant non coding RNA . This microRNA has now been predicted or experimentally confirmed in a range of plant species http microrna.sanger.ac.uk cgi bin sequences mirna summary.pl?fam MIPF0000008 MIPF0000008 . Animal miRNAs are transcribed as 70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a 22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory caf enzyme appears to be involved in processing. In this case the mature sequence comes from the 5 arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the stem loop hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA . Further reading cite journal last Reinhart first BJ coauthors Weinstein EG, Rhoades MW, Bartel B, Bartel DP year 2002 title MicroRNAs in plants journal Genes Dev volume 16 pages 1616&ndash 1626 pmid 12101121 doi 10.1101 gad.1004402 issue 13 pmc 186362 cite journal last Ambros first V year 2001 title microRNAs tiny regulators with great potential journal Cell volume 107 pages 823&ndash 826 pmid 11779458 doi 10.1016 S0092 8674 01 00616 X issue 7 cite journal ... Rfam id RF00073 name mir 156 microRNA precursor http microrna.sanger.ac.uk cgi bin sequences mirna summary.pl?fam MIPF0000008 MIPF0000008 miRNA precursor families molecular cell biology stub Category ... more details
Infobox rfam Name mir 124 microRNA precursor family image RF00239.jpg width caption Predicted secondary structure and sequence conservation of mir 124 Symbol mir 124 AltSymbols Rfam RF00239 miRBase MI0000443 miRBase family MIPF0000021 RNA type Gene MicroRNA miRNA Tax domain Eukaryota GO GO 0035195 GO 0035068 SO SO 0001244 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The miR 124 microRNA precursor is a small non coding RNA molecule that has been identified in flies http microrna.sanger.ac.uk cgi bin sequences mirna entry.pl?acc MI0000373 MI0000373 , ref cite journal last Lai first EC coauthors Tomancak P, Williams RW, Rubin GM year 2003 title Computational identification of Drosophila microRNA genes journal Genome Biol volume 4 pages R42&ndash pmid 12844358 doi 10.1186 gb 2003 4 7 r42 issue 7 pmc 193629 ref Caenorhabditis elegans nematode worms http microrna.sanger.ac.uk cgi bin sequences mirna entry.pl?acc MI0000302 MI0000302 , ref cite journal last Lim first LP coauthors Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP year 2003 title The microRNAs of Caenorhabditis elegans journal Genes Dev volume 17 pages 991&ndash 1008 pmid 12672692 doi 10.1101 gad.1074403 issue 8 pmc 196042 ref mouse http microrna.sanger.ac.uk ... loop hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3 arm ... targets the mRNA of the anti neural function protein SCP1 small C terminal domain phosphatase 1 . ref ... ref Makeyev et al showed that miR 124 directly targets PTBP1 PTB hnRNP I mRNA, which encodes a global repressor of alternative pre mRNA splicing in non neuronal cells. ref name pmid17679093 cite journal ... Differentiation by Triggering Brain Specific Alternative Pre mRNA Splicing journal Mol. Cell volume ... 3139456 ref References reflist 1 External links Rfam id RF00239 name miR 124 microRNA precursor family ... 124 Category MicroRNA miRNA precursor families molecular cell biology stub ... more details
Infobox rfam Name mir 395 microRNA precursor family image RF00451.jpg width caption Predicted secondary structure and sequence conservation of mir 395 Symbol mir 395 AltSymbols Rfam RF00451 miRBase MI0001007 miRBase family MIPF0000016 RNA type Gene MicroRNA miRNA Tax domain Eukaryota GO GO 0035195 GO 0035068 SO SO 0001244 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData mir 395 is a non coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir 395 is thought to target mRNA s coding for ATP sulphurylase s. ref cite journal last Jones Rhoades first MW coauthors Bartel DP year 2004 title Computational Identification of Plant MicroRNAs and Their Targets, Including a Stress Induced miRNA journal Mol Cell volume 14 pages 787&ndash 799 pmid 15200956 doi 10.1016 j.molcel.2004.05.027 issue 6 ref The mature sequence is excised from the 3 arm of the Stem loop hairpin . miR 395 is upregulated in Arabidopsis during sulphate limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases. ref cite journal last Liang first G coauthors Yang, F, Yu, D title MicroRNA395 mediates regulation of sulfate accumulation and allocation in Arabidopsis thaliana. journal The Plant journal for cell and molecular biology date 2010 Jun 1 volume 62 issue 6 pages 1046 57 pmid 20374528 ref ref cite journal last Liang first G coauthors Yu, D title Reciprocal regulation among miR395, APS and SULTR2 1 in Arabidopsis thaliana. journal Plant signaling & behavior date 2010 Oct volume 5 issue 10 pages 1257 9 pmid 20935495 ref References reflist 1 External links Rfam id RF00451 name mir 395 microRNA precursor family http microrna.sanger.ac.uk cgi bin sequences mirna summary.pl?fam MIPF0000016 miRBase family entry for mir 395 Category microRNA miRNA precursor families molecular cell biology stub ... more details