to Guanine G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M405 See also Singlenucleotide polymorphism Unique event polymorphism Human Y chromosome DNA haplogroup s List of Y STR markers External links http hpgl.stanford.edu publications AHG 2001 218 Y markers.doc Sequence information for 218 M series markers published by 2001 http www.isogg.org tree ISOGG YDNA SNP Index07.html ISOGG YDNA ...class wikitable Mutation number Nucleotide change Position base pair Total size base pair s Position Forward 5 3 Reverse 5 3 M1 YAP 291bp insertion M2 Adenine A to Guanine G 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc M3 M4 M8 M9 M15 M17 M20 M33 M35 M38 M40 M42 M45 M52 M55 M57 M60 M64.1 M75 M89 M91 M94 M95 M96 M105 M122 M124 M130 M131 M132 M139 M145 M168 M170 M172 M173 M174 M175 M176 M179 M201 M203 M207 M213 M214 M216 M217 M231 Guanine G to Adenine A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg M241 Guanine G to Adenine A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M242 Cytosine C to Thymine T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 Cytosine C to Thymine T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt M258 M267 Thymine T to Guanine G 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M268 M269 M285 Guanine G to Cytosine C 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M286 Guanine G to Adenine A 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M287 Adenine A to Thymine T 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M297 M299 M304 Adenine A to Cytosine C 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt M306 M335 Thymine T to Adenine A 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta M339 Thymine T to Guanine G 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt M340 Guanine G to Cytosine C 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa M342 Cytosine C to Thymine T 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact ... Data Category DNA Category Human evolution Category Population genetics Category Genetic genealogy ... more details
Image dna SNP.svg thumb DNA molecule 1 differs from DNA molecule 2 at a single base pair location a C T polymorphism . Multiple issues refimprove March 2011 primarysources March 2011 A singlenucleotide polymorphism SNP , pronounced snip is a DNA sequence variation occurring when a singlenucleotide ... allele frequencies for singlenucleotidepolymorphisms. There are variations between human populations ... region Synonymous Nonsynonymous Missense Nonsense Singlenucleotide polymorphism biology polymorphisms ... singlenucleotidepolymorphisms journal Nature volume 409 issue 6822 pages 928 33 year 2001 pmid 11237013 doi 10.1038 35057149 ref A single SNP may cause a Genetic disorder Mendelian disease . For Genetic ... first2 S.N. title Identification of base pairs in singlenucleotidepolymorphisms by MutS protein ... analysis of singlenucleotidepolymorphisms ternary encoding of genotypes. journal Analytical chemistry ..., two sequenced DNA fragments from different individuals, AAGC C TA to AAGC T TA, contain a difference in a singlenucleotide. In this case we say that there are two allele s C and T. Almost all common ... base nucleotide substitutions and short deletion and insertion polymorphisms http www.hgmd.cf.ac.uk ... &mdash Online tool that identifies polymorphisms in test DNA sequences. http www.informatics.jax.org ... open SNP genetics DEFAULTSORT SingleNucleotide Polymorphism Category Molecular biology Category ... cs Jednonukleotidov polymorfismus da Enkeltnukleotidpolymorfi de SingleNucleotide Polymorphism et ... are exploited in DNA profiling DNA fingerprinting , which is used in forensic science. Also, these genetic ... of genetic variations. For example, a single base difference in the Apolipoprotein E is associated ... polymorphisms. ref cite journal last Stenson first PD coauthors Mort, M, Ball, EV, Howells ... Variations in the DNA sequences of humans can affect how humans develop disease s and respond to pathogen ... and analysis. The OMIM database describes the association between polymorphisms and diseases e.g. ... more details
Asia ancestor Haplogroup F YDNA Haplogroup F descendants Haplogroup IJ YDNA IJ , Haplogroup K YDNA K mutations L15 S137, L16 S138, L69.1 G S163.1 members In human genetics , Haplogroup IJK is a Human Y chromosome DNA haplogroups human Y chromosome DNA haplogroup . Haplogroup IJK is a descendant branch of the macrohaplogroup Haplogroup F YDNA F with Haplogroup IJ YDNA haplogroup IJ and Haplogroup K YDNA haplogroup K as its attested descendants. ref name FTDNAadvSNP According to FamilyTreeDNA Family Tree DNA , the two Singlenucleotide polymorphism SNP s defining this haplogroup unite ... IJ YDNA IJ M429 P125, P123, P124, P126, P127, P129, P130, S2, S22 Haplogroup K YDNA K M9, P128, P131 ... IJK 1 Clade 1 Haplogroup IJ label1 Haplogroup IJ YDNA Haplogroup IJ 1 Clade 1 Haplogroup I label1 Haplogroup I YDNA Haplogroup I 1 Clade 1 Haplogroup I1. Northern Europe . 2 Haplogroup I2. Scattered around Europe 2 Haplogroup J label2 Haplogroup J YDNA Haplogroup J 2 Clade 1 Haplogroup J1 YDNA Haplogroup J1 . Middle East . 2 Haplogroup J2 YDNA Haplogroup J2 . Middle East . 2 Haplogroup K label2 Haplogroup K YDNA Haplogroup K 2 Clade 1 Haplogroup L YDNA Haplogroup L . South Asia . label2 Haplogroup MNOPS YDNA Macro haplogroup MNOPS 2 Haplogroup MNOPS 2 Clade 1 Haplogroup M YDNA Haplogroup M . New Guinea , Indonesia , Melanesia and Polynesia . label2 Haplogroup NO YDNA Macro haplogroup NO 2 Clade 1 Haplogroup N YDNA Haplogroup N . Mainly found in Northern Asia , Northern Europe , and Eastern Europe . 2 Haplogroup O YDNA Haplogroup O . Mainly found in East Asia , Southeast Asia , and Oceania . label3 Haplogroup P YDNA Macro haplogroup P 3 Clade 1 Haplogroup Q YDNA Haplogroup Q . Mainly found in Northern Asia and the Americas . label2 Haplogroup R YDNA Macro haplogroup R 2 Clade 1 Haplogroup R1 YDNA Macro haplogroup R1 . Europe , parts of Central Asia , South Asia , North America , and Cameroon . 2 Haplogroup R2 YDNA Haplogroup R2 . Mainly found in South Asia ... more details
such as singlenucleotidepolymorphisms, or SNPs. These SNPs mark the branch of a haplogroup, and indicate that all descendents of that haplogroup at one time shared a common ancestor. The YDNA SNP ... mutations M3 rs3894 members In human genetics , Haplogroup Q1a3a1 YDNA small phylogenetic name small and or Q M3 small mutational name small is a Human Y chromosome DNA haplogroup Y chromosome DNA haplogroup YDNA . ref name Genebase cite web title Learn about YDNA Haplogroup Q work Wendy Tymchuk ... to 20,000 years before present ref Haplogroup Q1a3a1 is a subclade of Haplogroup Q YDNA Haplogroup ... history of indigenous peoples of the Americas YDNA haplogroups in Indigenous peoples of the Americas Haplogroup Q1a3a1 is one of the few Y Chromosome haplogroup strictly associated with the indigenous peoples of the Americas, along with haplogroup Haplogroup C3 YDNA C3b P39 which is almost exclusively found in North America. This haplogroup is defined by the presence of the rs3894 M3 singlenucleotide polymorphism SNP . The M3 SNP is found downstream from the M242 SNP. M242 is the defining ... Y chromosome DNA haplogroup Haplogroup Q YDNA Haplogroup Q Haplogroup Q1a3 YDNA Haplogroup Q1a3 YDNA References references External links http www.familytreedna.com public Amerind 20Y The YDNA Haplogroup Q1a3a American Indian Project http www.qydna.org The YDNA Haplogroup Q Project http www.genebase.com learning article 16 Learn about YDNA Haplogroup Q DEFAULTSORT Haplogroup Q1a3a1 YDna Category Human YDNA haplogroups Q1a3a ca Haplogrup Q3 del cromosoma Y hum ... subclade. Haplogroup Q, possibly the youngest of the 20 Y chromosome haplogroups, originated with the SNP ... tcga tcgapdf Bortolini AJHG 03 YAmer.pdf Y Chromosome Evidence for Differing Ancient Demographic Histories ... more details
father to son male line s. Men within this haplogroup have Y chromosome s with the singlenucleotide ... Sforza ref ancestor Haplogroup BT YDNA BT descendants Haplogroup CF YDNA CF and Haplogroup DE YDNA DE mutations P9.1, M168, M294, V9, V41, V54, V189, and V226 In human genetics , Haplogroup CT ... human male lines except haplogroup A YDNA A and haplogroup B YDNA B , which are both found almost ... Cite journal title Use of Y Chromosome and Mitochondrial DNA Population Structure in Tracing ... of CT are in one of two major sub clades, Haplogroup CF YDNA CF and Haplogroup DE YDNA DE .... Citation needed date September 2010 In turn, DE is divided into an Asian haplogroup D YDNA haplogroup D and a predominantly Africa distributed haplogroup E YDNA haplogroup E , while CF is divided into an East Asian, American, and Oceanian haplogroup C YDNA haplogroup C and haplogroup F YDNA ... Haplogroup CF YDNA Haplogroup CF P143 Haplogroup C YDNA Haplogroup C M130, M216 Found in Asia , Oceania , and North America Haplogroup C1 YDNA Haplogroup C1 M8, M105, M131 Found in Japan Haplogroup C2 YDNA Haplogroup C2 M38 Found in Indonesia , New Guinea , Melanesia , Micronesia , and Polynesia Haplogroup C3 YDNA Haplogroup C3 M217, P44 Found throughout Eurasia and North America, but especially ... speaking peoples Haplogroup C4 YDNA Haplogroup C4 M347 Found in the indigenous Australians indigenous peoples of Australia Haplogroup C5 YDNA Haplogroup C5 M356 Found in South Asia , Central Asia , and Southwest Asia Haplogroup F YDNA Haplogroup F M89, M213 Found throughout Eurasia , Oceania , and Americas the Americas F1 P91, P104 F2 M427, M428 F3 P96 F4 P254 Haplogroup G YDNA M201, P257 Found in Europe , Western Asia , Central Asia , South Asia , and North Africa Haplogroup H YDNA M69, M370 ... Asia , North Africa and East Africa Haplogroup I YDNA M170, M258, P19, P38, P212, U179 Found in Europe Haplogroup J YDNA 12f2.1, M304 Found in Europe , Western Asia , North Africa and East Africa ... more details
Haplogroup R YDNA R descendants R2 and Haplogroup R2a YDNA R2a mutations M479 members n a Haplogroup R2 is a Human Y chromosome DNA haplogroups Y chromosome haplogroup characterized by genetic marker M479. Term history The first reference to the newly discovered Singlenucleotide polymorphism SNP ... now defines Haplogroup R2a YDNA Haplogroup R2a . The 2010 Y Chromosome Phylogenetic Tree was updated ... YDNA Haplogroup R and its Subclades 2010 . ref Note Before the discovery of the M479 SNP, the M124 ... Paragroup R2 1 label2 Haplogroup R2a YDNA Haplogroup R2a 2 Paragroup R2 ... center 0.071 center Haplogroup R2a Haplogroup R2a YDNA Haplogroup R2a is a Human Y chromosome DNA haplogroups Y chromosome haplogroup characterized by genetic markers L266, M124, P249, and P267, and is mainly ... Haplogroup R2 is a subgroup of Haplogroup R YDNA Haplogroup R M207 R M207 R R1 M306 R2 M479 R2 R2a M124, P249, P267, L266, PAGES00004, L381 R2a R2a1 L295 R2a2 L263 YDNA Description of the M479 SNP ...?card my066 Spread of R2 http www.familytreedna.com public india The India Genealogical DNA Project http www.familytreedna.com public R2 R2 Y Chromosome Haplogroup DNA Project http www.r2dna.org Digging into Haplogroup R2 YDNA http www.familytreedna.com public R2 M124 WTY R2 M124 WTY Walk Through the Y Project http www.familytreedna.com public R Arabia R Arabia YDNA Project http sites.google.com site r2dnainfo R2 Home r2 dna r2 frequency r2 frequencies worldwide?pli 1 List of R2 frequency DEFAULTSORT Haplogroup R2 YDna Category Human YDNA haplogroups R2 Category Human evolution ca Haplogrup ... vaop ncurrent abs ejhg2010146a.html A major Y chromosome haplogroup R1b Holocene era founder effect ... by an asterisk placed after the main haplogroup. Y chromosomes which are positive to the M479 SNP ... efefef Nucleotide change C to T scope row style background efefef Amplicon size bp reference sequence ... scope row style background efefef Y position 19294055 scope row style background efefef Primer forward ... more details
Infobox haplogroup name Q1a3 map origin date origin place Eurasia ancestor Q1a descendants Q1a3a, Q1a3b mutations L56, L57, M346 members Haplogroup Q1a3 is a subclade of Y DNA Haplogroup Q Y DNA Haplogroup Q . Haplogroup Q1a3 is defined by the presence of the M346 Single Nucleotide Polymorphism SNP and may therefore be referred to as Q M346 in shorthand . Distribution Q1a3 was first thought to be isolated to India ref A novel subgroup Q5 of human Y chromosomal haplogroup Q in India http www.ncbi.nlm.nih.gov pmc articles PMC2258157 . ref but has since been detected in the Middle East, ref Saudi Arabian Y Chromosome diversity and its relationship with nearby regions http www.biomedcentral.com 1471 2156 10 59 ref Europe Citation needed date September 2011 and the Americas. ref Restricted geographic distribution for Y Q paragroup in South America http www3.interscience.wiley.com journal 122506765 abstract. ref Associated SNP s Q1a3 is marked by the presence of the M346 SNP. Since the discovery of M346 several additional SNP s have been found to also be associated with Q1a3. These SNP s include L56 and L57. These SNP s appear to be parallel to M346. ref Family Tree DNA Draft Haplogroup Q Tree http ytree.ftdna.com index.php?name Draft&parent 31182976. ref Subgroups The International Society of Genetic Genealogy ISOGG defines the subgroups of Q1a3 as the following ref ISOGG 2010 Haplogroup Q Tree http www.isogg.org tree ISOGG HapgrpQ.html ref Haplogroup Q1a3a L53, L54, L55 Haplogroup Q1a3a1 Y DNA Haplogroup Q1a3a1 M3 Haplogroup Q1a3a1a M19 Haplogroup Q1a3a1b M194 Haplogroup Q1a3a1c M199, P106, P292 Haplogroup Q1a3b M323 See also Human Y chromosome DNA haplogroup Haplogroup Q Y DNA Haplogroup Q Haplogroup Q1a3a1 Y DNA Haplogroup Q1a3a1 Y DNA References references External links http www.familytreedna.com public yDNA Q The Y DNA Haplogroup Q Project DEFAULTSORT Haplogroup Q1a3 Y Dna Category Human Y DNA haplogroups Q1a3 ... more details
DNA NO descendants O , haplogroup O1 YDNA O1 , haplogroup O2 YDNA O2 , haplogroup O3 YDNA O3 ... DNA haplogroup Y chromosome DNA haplogroup . Haplogroup O is a close cladistic brother group with Haplogroup N YDNA Haplogroup N , and is one of several descendants of haplogroup K YDNA Haplogroup K the intermediates being haplogroup MNOPS YDNA Haplogroup MNOPS and haplogroup NO YDNA Haplogroup NO . Origins Haplogroup O is a descendant haplogroup of haplogroup NO YDNA Haplogroup NO M214 , and first ... or East Asia . ref name ISOGG http www.isogg.org tree ISOGG HapgrpO.html YDNA Haplogroup O and its ... tree of human Y chromosomes with haplogroup N YDNA Haplogroup N , which is common throughout North ... Asia , Central Asia , and Oceania . Among the subbranches of Haplogroup O are Haplogroup O1 YDNA Haplogroup O1 , Haplogroup O2 YDNA Haplogroup O2 , and Haplogroup O3 YDNA Haplogroup O3 . Paragroup ..., nearly all of these Korean O M175 xO1a,O2a,O3 Y chromosomes probably belong to Haplogroup O2b YDNA ... M176 , or Haplogroup O2b M176. Haplogroup O1 MSY2.2 main Haplogroup O1 YDNA Haplogroup O1a M119 ... Haplogroup O2 YDNA Haplogroup O2a YDNA Haplogroup O2a M95 Found frequently among Austro Asiatic ... . ref name Fornarino2009 Haplogroup O2b YDNA Haplogroup O2b M176 Found frequently among Koreans ... O3 YDNA Found frequently among populations of East Asia , Southeast Asia , and culturally ... Asiatic Haplogroup O3 YDNA O3 M122 1 clade label1 Sino Tibetan languages Sino Tibetan Haplogroup O3 YDNA O3a3c M134 1 clade 1 Sinitic languages Sinitic Haplogroup O3 YDNA O3a3c1 M117 2 Tibeto Burman languages Tibeto Burman label2 Hmong Mien languages Hmong Mien Haplogroup O3 YDNA O3a3b M7 2 clade 1 clade 1 Hmong ... Asiatic Haplogroup O2a YDNA O2a M95 1 clade 1 Munda languages Munda 2 ... O1 YDNA O1a M119 2 clade label1 Austronesian languages Austronesian 1 clade ... more details
as singlenucleotidepolymorphismsSinglenucleotide polymorphism SNPs . It is a subclade of Haplogroup I YDNA Haplogroup I . Before a reclassification in 2008, ref Tatiana M. Karafet et al ... I1a http lists.rootsweb.com index other DNAYDNA HAPLOGROUP I.html Mailing List for YDNA Haplogroup ... Haplogroup I YDNA I descendants mutations M253, M307, P30, P40 members People of Northern Europe .... ref http archiver.rootsweb.com th read YDNA HAPLOGROUP I 2007 12 1198467954 RootsWeb Discussion on YDNA HAPLOGROUP I Mailing List ref Other researchers including Peter A. Underhill of the http hpgl.stanford.edu ... th read YDNA HAPLOGROUP I 2008 03 1205856226 Nordtvedt Overview of New Phylogenetic ... prevalent Haplogroup R YDNA Haplogroup R . When SNPs are unknown or untested and when short tandem ... argued that, at least for I1, ref http archiver.rootsweb.com th read ydna haplogroup i 2007 04 1176386234 ... YDNA Haplogroup I and its Subclades 2008 ref formerly I1a I1 I1a M21 formerly I1a2 I1b ... including both Germanic and Uralic peoples of the region nearly all of the Haplogroup I YDNA Haplogroup .... Mitochondrial DNA as well as YDNA of northern Germanic origin was discovered at substantial rates ... his family Y chromosome DNA has not been tested. The name de Gaulle likely came from De Walle which ... Rurikids , Haplogroup N YDNA N1c1a and R1a , ref http www.familytreedna.com public rurikid index.aspx ... also be other explanations for I1 YDNA s in Turkey. Tatar Turks are known to be over 18 I1 .... ref http dgmweb.net genealogy DNA Hg I subclades FTDNA order.shtml YDNA Haplogroup I Modal ... DNA HAPLOGROUP I 2008 04 1209560622 I1a and P109 & http archiver.rootsweb.ancestry.com th read YDNA ... , through genealogy and the testing of his descendants, has been placed within YDNA haplogroup I1 ... th read ydna haplogroup i 2007 01 1168077369 Blood groups and Haplogroup I ref Spencer ... Human Y chromosome DNA haplogroups Haplogroup I YDNA Haplogroup I2 YDNA Genetic history of Europe ... more details
years BP origin place Asia ref name Karafet ancestor Haplogroup DE YDNA DE descendants Haplogroup D1 YDNA D1 , D2, D3 mutations M174, IMS JST021355, PAGES00003 members In human genetics , Haplogroup D M174 is a Y chromosome haplogroup . Both D and E lineages also exhibit the singlenucleotide polymorphism Haplogroup CT YDNA M168 which is present in all Y chromosome haplogroups except haplogroup A YDNA A and haplogroup B YDNA B , as well as the YAP unique event polymorphism , which is unique ... YDNA haplogroup E contains the distinctive YAP genetics YAP polymorphism which indicates their common ... Overview Like haplogroup C YDNA haplogroup C , D is believed to represent the Great Coastal Migration ... exclusively Haplogroup D chromosomes, although haplogroup C3 YDNA Haplogroup C3 chromosomes also ... exclusively in each of the populations that contains a large percentage of individuals whose Y chromosomes belong to Haplogroup D Haplogroup D1 YDNA Haplogroup D1 among the Tibetan people Tibetans ... tree ISOGG HapgrpD.html YDNA Haplogroup D and its Subclades 2010 ref Haplogroup DE YDNA DE D M174 ... DE M1 xD M174 YDNA in one Southern Altaian individual from Beshpeltir 1 43 2.3 . ref name Kharkov2007 ... See also Haplogroup DE YDNA Haplogroup E YDNAYDNA References cite journal author Underhill PA, Kivisild T title Use of y chromosome and mitochondrial DNA population structure in tracing human ... Category Human YDNA haplogroups D Category Evolution ca Haplogrup D del cromosoma Y hum de Haplogruppe D YDNA es Haplogrupo D ADN Y fr Haplogroupe D Y ADN hi ru D ... before present. ref name Shi2008 cite journal author Shi H, Zhong H, Peng Y, et al. title Y chromosome ... Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF title New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree journal Genome Research ... D Y chromosomes , Haplogroup D2 among the various populations of the Japanese Archipelago, Haplogroup ... more details
Lists http archiver.rootsweb.com th index YDNA HAPLOGROUP I YDNA HAPLOGROUP I Archives http lists.rootsweb.com index other DNAYDNA HAPLOGROUP I.html YDNA HAPLOGROUP I Mailing List at Rootsweb.com ...Infobox haplogroup name I map Haplogroup I YDNA .PNG origin date 25,000 30,000 years BP origin place Europe or Southwest Asia ancestor Haplogroup IJ YDNA IJ descendants Haplogroup I1 YDNA I1 , Haplogroup I2 YDNA I2 mutations M170, M258, P19, P38, P212, U179 members Bosnia and Herzegovina 65 , Bosnia ... I the letter I, not the number 1 is a Human Y chromosome DNA haplogroup Y chromosome DNA haplogroup , a subgroup of haplogroup IJ YDNA haplogroup IJ , itself a derivative of Haplogroup IJK YDNA Haplogroup IJK . YDNA Haplogroup I is predominantly a European haplogroup today. It represents ... 10.1046 j.1529 8817.2004.00092.x author Nasidze Ivan et al. year 2004 title , Mitochondrial DNA and Y ... by Mitochondrial DNA and Y Chromosomes url journal American Journal of Human Genetics volume 74 ... History of the Dniester Carpathians Evidence from Alu Insertion and Y Chromosome Polymorphisms, Dissertation .... Haplogroup I1 YDNA I1 M253 L64, L75, L80, L81, L118, L121 S62, L123, L124 S64, L125 S65, L157 ... L258 I1e I211 I1f L338 I2 M438 L68, M438 P215 S31 . For details on subclades see Haplogroup I2 YDNA ... of the population. Main Haplogroup I1 YDNA Image with unknown copyright status removed Image I1aHAPLOGROUP.jpg ... the modern French and Italian populations. I M438 Main Haplogroup I2 YDNA Image HaplogroupI2.png ... . This suggestion is supported by recent genetic studies regarding YDNA Haplogroup I2b2 L38 have ... Human Y chromosome DNA haplogroups Haplogroup I1 YDNA Haplogroup I2 YDNA References reflist ... YDNA Haplogroup I and its Subclades refend External links Phylogenetic tree and distribution maps http www.isogg.org tree ISOGG HapgrpI08.html YDNA Haplogroup I and Its Subclades from the International ...?tuId 12 Frequency Distributions of YDNA Haplogroup I and its subclades with Video Tutorial http ... more details
Infobox haplogroup name IJ map Haplogroup IJ YDNA .jpg origin date 35,000 40,000 years BP Citation needed date August 2011 origin place Southwest Asia ancestor Haplogroup IJK YDNA IJK descendants Haplogroup I YDNA I , Haplogroup J YDNA J mutations M429 P125, P123, P124, P126, P127, P129, P130, S2, S22 In human genetics , Haplogroup IJ Cro Magnon is a Human Y chromosome DNA haplogroups human Y chromosome DNA haplogroup . Haplogroup IJ is a descendant branch of Haplogroup IJK YDNA Haplogroup IJK ref http www.isogg.org tree ISOGG YDNATreeTrunk08.html ISOGG Y tree showing HG IJK ref which in turn derives from the greater Haplogroup F YDNA Haplogroup F . Descendants are Haplogroup I YDNA Haplogroup I Europid and Haplogroup J YDNA Haplogroup J Arabid . Haplogroup IJ derived populations account ... 2008 Haplogroup I YDNA I M170, P19, M258, P38, P212, U179 Haplogroup I notation updated to ISOGG 2008 I Haplogroup I1 YDNA I1 M253, M307, M450 S109, P30, P40, S62, S63, S64, S65, S66, S107, S108, S110 ... I1d P259 Haplogroup I2 YDNA I2 M438 P215 S31 formerly I1b I2 I2a P37.2 formerly I1b1 Typical of the South ... I2b1d P95 formerly I1b2a4 Haplogroup J YDNA J 12f2.1, M304, S6, S34, S35 J Haplogroup J1 YDNA ... J2 YDNA J2 M172 Typical of populations of Mesopotamia , Anatolia , Southern Europe , and the Caucasus ... See also Haplogroup Human Y chromosome DNA haplogroups YDNA haplogroups by ethnic groups Haplogroup I YDNA Haplogroup I1 YDNA Haplogroup I2 YDNA Haplogroup J YDNA Haplogroup J2 YDNAYDNA DEFAULTSORT Haplogroup Ij YDna Category Human YDNA haplogroups IJ Category Human evolution hi ... Y chromosome has been found among any modern human population the existence of the Haplogroup IJ node has been inferred from the fact that certain mutations are shared in common among all Y chromosomes ... author Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF title New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree journal Genome ... more details
YDNA haplogroup P and it is defined by the M207 singlenucleotide polymorphism SNP mutation . Origins ...Infobox haplogroup name R map Haplogroup R YDNA .jpg origin date 26,800 19,900 34,300 years ago ref ... Asia ancestor haplogroup P YDNA P which origin is believed to be in west central Asia descendants R , Haplogroup R1 YDNA R1 , haplogroup R2 YDNA R2 mutations R M207 UTY2 , P224, P227, P229, P232, P280, P285, S4, S8, S9 and V45. ref name ISOGG 2010 br Haplogroup R1 YDNA R1 M173 br haplogroup R1a YDNA R1a L62, L63 br haplogroup R1b YDNA R1b M342 br haplogroup R2 YDNA R2 M479 br haplogroup R2a YDNA R2a L266, M124, P249, and P267. members In human genetics , haplogroup R is a Human Y chromosome DNA haplogroup Y chromosome DNA haplogroup very common throughout Europe , Central Asia and South ... in Central Asia or South Asia, where its ancestor haplogroup P YDNA Haplogroup P is most often ... R 1 label2 Haplogroup R1 YDNA Haplogroup R1 2 Clade 1 Paragroup R1 2 Clade label1 Haplogroup R1a YDNA Haplogroup R1a 1 Clade 1 Paragroup R1a 2 Haplogroup R1a1 YDNA Haplogroup R1a1 3 Clade label1 Haplogroup R1b YDNA Haplogroup R1b 1 Clade 1 Paragroup R1b 2 Haplogroup R1b1 YDNA Haplogroup R1b1 label3 Haplogroup R2 YDNA Haplogroup R2 3 Clade 1 Paragroup R2 2 Clade label1 Haplogroup R2a YDNA Haplogroup R2a 1 Clade 1 Paragroup R2a 2 Haplogroup R2a1 YDNA Haplogroup R2a1 Distribution ... . ref R1 Image Haplogroup R YDNA .PNG thumb 350px Spread of Haplogroup R in Native populations ... R1 YDNA The majority of members of haplogroup R belong to its subgroup R1, defined by marker ... R1a YDNA R1a1a M17 and Haplogroup R1b YDNA R1b1b2 M269. ref name Semino2000 Harvcolnb Semino et ... haplogroup in Indigenous peoples of the Americas following Haplogroup Q YDNA haplogroup Q , and spreads ... Haplogroup R1a YDNA The highest levels of R1a 50 are found across the Eurasian Steppe and South Asia ... more details
place Africa or Asia ancestor Haplogroup CT YDNA CT descendants Haplogroup D YDNA D , Haplogroup E YDNA E mutations M1 YAP, M145 P205, M203, P144, P153, P165, P167, P183 members In human genetics , Haplogroup DE is a human Y chromosome DNA haplogroup . It is defined by the singlenucleotide ... binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree journal ... of DE male lines can be categorized as being in either Haplogroup D YDNA , which likely originated in Asia , the only place where it has been found, ref name Karafet or Haplogroup E YDNA haplogroup ... was based on the fact that older African lineages, such as Haplogroup A YDNA haplogroups A and Haplogroup B YDNA B , were YAP negative whereas the younger lineage, Haplogroup E YDNA haplogroup ... M174 mutation that defines haplogroup D YDNA haplogroup D . The M174 allele is found in the ancestral ... to Africa, and at the time of writing that there was no unequivocal Y chromosome YDNA , mitochondrial ... C YDNA Haplogroup C seems to have originated in Asia at a similar time to Haplogroup DE s origin ... haplogroup R1b YDNA Haplogroup R1b1 18 23kya , which has been observed with especially high frequency among the members of some tribes in northern Cameroon , and Haplogroup T YDNA Haplogroup T 25 ... cite journal author Underhill PA, Kivisild T title Use of y chromosome and mitochondrial DNA .... DE M1 YAP, M145 P205 , M203, P144, P153, P165, P167, P183 Haplogroup D YDNA D M174, 021355 Haplogroup E YDNA E SRY4064, M96, P29, P150, P152, P154, P155, P156, P162 YDNA See also Haplogroup D YDNA Haplogroup E YDNA References reflist External links DEFAULTSORT Haplogroup De YDna Category Human YDNA haplogroups DE Category Human evolution ca Haplogrup DE del cromosoma Y hum es Haplogrupo ... referred to by the most well known unique event polymorphism UEP which defines it, the Y chromosome Alu Polymorphism biology Polymorphism YAP . The YAP mutation was caused when a strand of DNA called ... more details
DNA Haplogroup R1 , which is defined by singlenucleotide polymorphism SNP mutation M173. Besides R1a, R1 also has the subclades Haplogroup R1b YDNA R1b , defined by the M343 mutation, and the paragroup ... Underhill Myres Rootsi Metspalu 2009 . See List of R1a frequency by population further YDNA haplogroups ... right List of R1a frequency by population Human Y chromosome DNA haplogroups Genetic history of Europe ...Infobox haplogroup name R1a map Haplogroup R1a YDNA .jpg origin date Less than 18,500 YBP ref http www.nature.com ... probably South Asia , or Central Eurasia. ancestor Haplogroup R1 YDNA R1 R M173 mutations M420 also ... Europe , Eastern Europe , Central Asia , South Asia and Siberia . See List of R1a frequency by population Haplogroup R1a is the phylogenetic name of a major clade of Human Y chromosome DNA haplogroups ... by the Singlenucleotide polymorphism SNP mutation M420. The recent discovery of M420 resulted ... are phylogeny phylogenetic names, aimed at marking positions in a family tree. Names of singlenucleotide ... title Haplogroup R family tree clade Clade label1 br Haplogroup R YDNA Haplogroup ... Haplogroup R1b YDNA R1b label3 ? 3 R1 2 Haplogroup R2 YDNA Haplogroup R2 R1a, distinguished ... YDNA from previous studies, concluded that a South Asian R1a1a origin was the most likely proposal ... contrary to a connection Corded Ware period human remains at Eulau from which YDNA was extracted ... DNA Project Somerled center YDNA center Notes Reflist group note Reflist 30em References Refbegin ... assay of Y SNP typing by SNaPshot minisequencing on ancient DNA journal International Journal ... V. last3 Stoneking first3 M. title Y Chromosome and Mitochondrial DNA Variation in Lithuanians ... files Klyosov2.pdf title DNA Genealogy, Mutation Rates, and Some Historical Evidence Written in Y ..., is much more common than the others in all major geographical regions. R1a1a, defined by the Singlenucleotide polymorphism SNP mutation M17, is particularly common in a large region extending from ... more details
learning article 15 Learn about YDNA Haplogroup G Genebase.com ref origin place South Asia or Southwest Asia ancestor Haplogroup F YDNA F brother groups Haplogroups H, IJ parent of I and J ... . It is a branch of Haplogroup F YDNA Haplogroup F M89 . Haplogroup G has an overall low frequency ... 2010 e1000536. ref G2a was found in 20 out of 22 samples of ancient YDNA from Treilles , the type ... New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree ... L177.1 , L177.2 , L177.3 G2a4 L91 G2a5 L293 G2b M287 Haplogroup G2c YDNA G2c M377, L72, L183 G2c ... L13 S131 U13 and G2c YDNA G2c M377 . Characteristics of Haplogroup G Subgroups The International ... new L or S designated SNP tests. In 2009 10, Family Tree DNA s Walk through the Y Project, sequencing ... or M342 and its subgroups Main Haplogroup G1 YDNA Almost all haplogroup G1 persons have the value of 12 at short tandem repeat STR marker DYS392 and all will have the M285 or M342 Singlenucleotide ... P16 and its subgroup Main Haplogroup G2a1 YDNA Haplogroup G2a1 and its one subgroup G2a1a represent ... subgroups Main Haplogroup G2a3b1 YDNA The G2a3b1 definable subgroups are heavily concentrated ... test subject. G2c M377 and its subgroup Main Haplogroup G2c YDNA A clade of closely related Ashkenazi Jews represent virtually all Haplogroup G2c YDNA G2c persons, with just three other ... tested so far have a rare null value for the DYS 425 list of Y STR markers marker , a missing T allele of the DYS371 palindromic list of Y STR markers STR , the result of a RecLOH event, a finding not yet ... 5 pmc 2771134 ref Geographical Distribution Main Haplogroup G YDNA Country by Country Knowing the distribution ... test on his grandson his son Vasily s son Alexander Burdonsky , shows his YDNA haplogroup ... HapgrpG.html YDNA Haplogroup G and its subclades from the 2011 ISOGG haplotree http www.ysearch.org ... www.britishislesdna.com British Isles DNA Project YDNA DEFAULTSORT Haplogroup G YDna Category Human ... more details
Haplogroup G YDNA brother subgroup Haplogroup G2 descendants G1a, G1b mutations M285 G1 , P20 G1a , L201, L202, L203 G1a1 , P76 G1b In human genetics , Haplogroup G1 M285 is a Y chromosome haplogroup . G1 is a branch of Haplogroup G YDNA M201 . Haplogroup G1 has an extremely low frequency in almost ... Singlenucleotide polymorphism SNP mutation which characterizes this group. This value of 12 is also ... Jews with Haplogroup G YDNA . Among available 67 marker G1 STR samples, ref name ReferenceA ... YDNA haplogroups by ethnic groups Haplogroup G YDNA Country by Country References Reflist External ... tree ISOGG HapgrpG.html YDNA Haplogroup G and its subclades from the 2010 ISOGG haplotree http www.ysearch.org ... G DEFAULTSORT Haplogroup G1 YDna Category Human YDNA haplogroups G1 ... University . M285 has the following characteristics The reference ID number is rs13447378.....Y ... journal author Karafat, T., et al. title New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree journal Genome Research volume 18 issue 5 pages 830 38 year ... Excavating Y chromosome haplotype strata in Anatolia journal Human Genetics volume 114 issue 2 pages ... from T to C. The L89 designation was provided by Family Tree DNA . Dating of G1 Origin While ... concentration of G1 and its subgroups in a single country is in Iran , with next most frequent ..., Cadenas AM, Gayden T, Underhill PA, Herrera RJ title Iran tricontinental nexus for Y chromosome driven ... cite journal author Cinnioglu, C., et al. title Excavating Y chromosome haplotype strata in Anatolia ..., M., et al. title Geographical structure of the Y chromosomal genetic landscape of the Levant a coastal ..., A. Zalan, A., et al., title A Y Chromosomal Comparison of the Madjars Kazakhstan and the Magyars ... http archiver.rootsweb.ancestry.com th read GENEALOGY DNA 2007 07 1185576938 Report of Thomas ... results for each. The technical features of P20 are Y position is 25029911 23396163.....forward primer ... more details
mutations P16 G2a1 , P18 G2a1a In human genetics , Haplogroup G2a1 P16 is a Y chromosome haplogroup . It is a branch of haplogroup G YDNA M201 , and more specifically of haplogroup G2 P287 and most ... also have the distinctive mutation at Singlenucleotide polymorphism SNP P16 that characterizes G2a1 .... In the Nasidze study of YDNA in various Caucasus groups, ref name Nasidze, I. et al. 2004 588 ... See also genetic genealogy YDNA haplogroups by populations of the Caucasus Haplogroup G YDNA Country ... tutorial from Genebase http www.isogg.org tree ISOGG HapgrpG.html YDNA Haplogroup G and its subclades ... Search&uid Y Search Users with Haplogroup G DEFAULTSORT Haplogroup G2a1 YDna Category Human YDNA ... archiver.rootsweb.ancestry.com url http archiver.rootsweb.ancestry.com th read GENEALOGY DNA 2007 07 ... a common pool of Y chromosome biallelic haplotypes journal Proc Natl Acad. Sci. USA volume 97 issue ... 2000PNAS...97.6769H ref These are the specifications listed for P16 located on the Y chromosome at 19434578 ... Karafat, T., et al. title New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree journal Genome Research volume 18 issue 5 pages 830 38 year 2008 pmid ... journal author The Y Chromosome Consortium title A Nomenclature System for the Tree of Human Y Chromosomal ... on the Y chromosome at 25751219 25029753 23396005....forward primer is tggatctgattcacaggtag....reverse ... in different time periods as they migrated from the east. Examination of ancient DNA from ... cite journal author Keyser C, et al. title Ancient DNA provides new insights into the history of south ... S, Crub zy E, Ludes B title First successful assay of Y SNP typing by SNaPshot minisequencing on ancient DNA journal Int. J. Legal Med. volume 121 issue 6 pages 493 9 year 2007 month November pmid 17534642 ... in the area to the north of the Caucasus lacks both features. Famous members See also List of genetic ... more details
. These subclades are also defined by singlenucleotidepolymorphisms SNPs or unique event ...Infobox haplogroup name Q map Haplogroup Q YDNA .PNG origin date 17,000 to 22,000 years ago ref name ... to a Single, Recent Entry of Native American Y Chromosomes into the Americas year 2003 last1 Zegura ... http www.isogg.org tree ISOGG HapgrpQ.html YDNA Haplogroup Q and its Subclades 2010 ref the Indian Subcontinent , ref name Sharma07 Siberia ref name Genebase cite web title Learn about YDNA Haplogroup ... before present ref ancestor haplogroup P YDNA P descendants Q1 P36.2 , Q mutations M242 members Indigenous ... Q M242 is a Human Y chromosome DNA haplogroup Y chromosome DNA haplogroup . Origins Haplogroup Q is one of the two branches of Haplogroup P YDNA haplogroup P M45 . Haplogroup Q is believed to have ... DNA GRC. This SNP may represent a native Mexican lineage. L191 may represent single family or limited ... doi 10.1101 gr.7172008 title New binary polymorphisms reshape and increase resolution of the human Y ... determined to be unsuitable for inclusion on the ISOGG YDNA tree. ref Private communication reported between Charles Moore, of ISOGG, and Rebekah Adele Canada, of the FTDNA YDNA Q Project. ref Further ... Q. Haplogroup P YDNA P Q M242 P36.2, L232, L273, L274 MEH2, L472, L528 M120, N14, M265 M25 ... of the 2010 update. ref cite website url https www.familytreedna.com ydna haplotree.aspx title YDNA Haplotree Family Tree DNA uses the Y Chromosome Consortium tree and posts it on their website. ref Haplogroup P YDNA P Q M242 Q1 P36.2 Q1a MEH2 Q1a1 M120, N14, M265 Q1a2 M25, M143 Q1a3 L213, L53, L54 ..., M265 N14 Q1a2 M25, M143 Haplogroup Q1a3 YDNA Q1a3 L56, L57, M346, L528 Q1a3a L53, L54, L55, L213, L331 Haplogroup Q1a3a YDNA Q1a3a1 M3 Q1a3a1a M19 Q1a3a1b M194 Q1a3a1c M199, P106, P292 Q1a3a2 L191 ... genetics YDNA haplogroups in Indigenous peoples of the Americas Haplogroup Q is the predominant ... 46 . ref name genetree cite web title Frequency Distribution of YDNA Haplogroup Q M3 url http www.genetree.com ... more details
N YDNA Haplogroup N and Haplogroup O YDNA Haplogroup O , which together are overwhelmingly ... gatherer and farmer Y chromosomes, The Japan Society of Human Genetics, Springer Verlag 2005 ref Haplogroup NO M214 xN1 LLY22g, O M175 YDNA also has been found sporadically in samples of Han Chinese ... New Binary Polymorphisms Reshape and Increase Resolution of the Human Y Chromosomal Haplogroup ..., P192, P193, P194, P195 NO N M231 Haplogroup N YDNA Main N Article O M175, P186, P191, P196 Haplogroup O YDNA Main O Article References reflist See also Human Y chromosome DNA haplogroup Genealogical DNA test Y chromosome haplogroups by populations YDNA External links Category Human YDNA haplogroups NO Category Human evolution es Haplogrupo NO ADN Y hi ru NO Y ... Underlies Y Chromosome Stratification Across Indonesia, MBE Advance Access published March 5 ... more details
Basin and North East to Manchuria. The descendant haplogroups of P include haplogroup Q YDNA Q M242 and haplogroup R YDNA R M207 . Distribution Haplogroup P is distributed commonly in Europe, Central ... S8, PG83 P haplogroup Q YDNA Q M242 haplogroup R YDNA R M207, P224, P227, P229, P232, P280, P285 ...?card my044 Spread of Haplogroup P , from The Genographic Project , National Geographic YDNA Category Human YDNA haplogroups P ca Haplogrup P del cromosoma Y hum cs Haploskupina P YDNA de Haplogruppe P YDNA es Haplogrupo P ADN Y fr Haplogroupe P hi ru P Y ... cite journal doi 10.1073 pnas.0507714103 title A prehistory of Indian Y chromosomes Evaluating demic ... more details
Infobox haplogroup name T map Distribution Haplogroup T YDNA II.svg origin date 19,000 34,000 years ... humbiol vol83 iss1 3 ref ancestor Haplogroup LT YDNA LT descendants T1, T mutations ... In human genetics , Haplogroup T is a Human Y chromosome DNA haplogroups human Y chromosome DNA ... UEP which defines this clade is generally considered to be the singlenucleotide polymorphism SNP ... YDNA R1 , Haplogroup J YDNA G and Haplogroup J YDNA J lineages that entered Africa from Eurasia .... Later expansions of populations carrying the Haplogroup E1b1b YDNA E1b1b , Haplogroup E1b1a YDNA E1b1a , G and J NRY lineages may have overwhelmed the T clade bearers in certain localities ... by Analysis of Y Chromosome, mtDNA, and Alu Polymorphisms, Human Biology , August 2006, v. 78 ... N. Maca Meyer, P. S nchez Velasco, C. Flores et al. , Y Chromosome and Mitochondrial DNA Characterization ... en.wikipedia.org w index.php?title Haplogroup T YDNA &action edit& Rhineland ers Ripuarian language ... et al. Differentiation of Mitochondrial DNA and Y Chromosomes in Russian Populations , Human ... , ref name Lauc2004 Lovorka Barac Lauc et al. Y chromosome STR polymorphisms in a Serbian ... ref ref name Kasperaviciute2004 D. Kasperaviciute et al. , Y Chromosome and Mitochondrial DNA Variation ..., G. Passarino, A. Torroni, and A.S. Santachiara Benerecetti, Y chromosome and mtDNA polymorphisms in Iraq ... et al., Y chromosome speci c YCAII, DYS19 and YAP polymorphisms in human populations a comparative ... analysis of Y chromosomal polymorphisms reveals signatures of population movements from Central Asia ... Y chromosome haplotypes reveal strong regional structure within a single ethno national group, Journal ... in Isfahan , ref name Nasidze 2004 Nasidze et al. Mitochondrial DNA and Y Chromosome Variation in the Caucasus ... for Y Chromosomal DNA Variation in North Africa, American Journal of Human Genetics 75 338 345, 2004 ... publications HM 2001 v17 p271.pdf Maori origins, Y chromosome haplotypes and implications for human ... more details
Pp semi small yes pp move indef Infobox haplogroup name R1b map Haplogroup R1b YDNA .jpg origin date ... R1 YDNA R1 descendants R1b1a R P297 , R1b1b R M335 , R1b1c R V88 mutations 1. M343 defines ... , Bashkirs File Distribution Haplogroup R1b YDNA version 2.gif 300px thumb Approximate distribution ... words now identified by the presence of the singlenucleotide polymorphism SNP mutation M343 ... Society of Genetic Genealogy ISOGG YDNA Haplogroup R and its Subclades ref Also prior to 2002, major YDNA signatures based on markers other than SNPs were recognized. In Western Europe the STR haplotype ... R1b is a sub clade within the much larger Eurasian Haplogroup MNOPS YDNA MNOPS macro haplogroup ..., and this whole group, along indeed with all of Haplogroup F YDNA macro haplogroup F , is believed to have originated in Asia. Clade label1 Haplogroup MNOPS YDNA Macro haplogroup MNOPS 1 Clade 1 Haplogroup M YDNA Haplogroup M . New Guinea , Melanesia , eastern Indonesia , and Polynesia . label2 Haplogroup NO YDNA Macro haplogroup NO 2 Clade 1 Haplogroup N YDNA Haplogroup N . Mainly found in North Asia and northeastern Europe. 2 Haplogroup O YDNA Haplogroup O . Mainly found in East Asia, Southeast Asia, and Austronesia . label3 Haplogroup P YDNA Macro haplogroup P 3 Clade 1 Haplogroup Q YDNA Haplogroup Q . Mainly found in North Asia and the Americas. label2 Haplogroup R YDNA Macro haplogroup R 2 Clade label1 Haplogroup R1 YDNA Macro haplogroup R1 1 Clade 1 Haplogroup R1a YDNA Haplogroup ... found in Western Europe, Central Africa and South West Asia. 2 Haplogroup R2 YDNA Haplogroup R2 . Mainly found in South Asia. 4 Haplogroup S YDNA Haplogroup S . New Guinea , Melanesia , and eastern ... of the Dniester Carpathians Evidence from Alu Insertion and Y Chromosome Polymorphisms periodical Dissertation ... in modern populations of Germany, Ireland and the USA while 2 were in Haplogroup G YDNA G2a ... and Koch title Kinship and Y Chromosome Analysis of 7th Century Human Remains Novel DNA Extraction ... more details
YDNA J mutations M267 descendants J1a, J1b, J1c members Semitic populations generally, and also parts of the Caucasus including Dagestan . See article text. In human genetics , YDNA haplogroup J1 , also known as J M267, is a sub haplogroup of Haplogroup J YDNAYDNA haplogroup J , along with its sibling clade Haplogroup J2 YDNAYDNA haplogroup J2 . Men with this type of YDNA share a common patrilineality paternal ancestry, which is demonstrated and defined by the presence of the singlenucleotide ... M62 J1b M365.1 J1c L136 J1c1 M390 formerly J1c J1c2 P56 formerly J1d Haplogroup J1c3 YDNA J1c3 P58 ... Haplogroup J1c3d YDNA J1c3d L147.1 J1c3d J1c3d1 L174.1 J1c3d2 L222.2 J1c3d2 J1c3d2a L65.2 S159.2 ... P58 is the most common YDNA haplogroup amongst men from all of this region. border 1 align center style ... Poloni first2 E author2 link title A Predominantly Neolithic Origin for Y Chromosomal DNA Variation ... Khodjet el khil last4 Gonzalez year 2011 title Mitochondrial DNA and Y chromosome microstructure in Tunisia ... title YDNA Haplogroup J and its Subclades 2011 work publisher International Society of Genetic ... Israeli Populations From Y Chromosome and Mitochondrial DNA Sequence Variation periodical Human Mutation ... last9 Bosch first9 Elena pmc 2668035 External links http www.familytreedna.com public YDNA J ... tree ISOGG HapgrpJ.htm YDNA Haplogroup J and its Subclades 2011 YDNA DEFAULTSORT Haplogroup J1 YDna Category Human YDNA haplogroups J Category Human evolution ar 1 ...Infobox haplogroup name J1 map HG J1 ADN Y .PNG origin date 4,000 34,000 years before present ref name ... M62. ref harvtxt Y Chromosome Consortium YCC 2002 ref But with one notable exception, J1c3, most of these are not common ... and ceramic figurines with Y chromosome lineages, Antiquity , vol. 76 2002 , pp. 704 714 ref ref J. Chiaroni, R.J. King and Peter A. Underhill, Correlation of annual precipitation with human Y chromosome ... regions. They list three regions which are particularly important to their proposal The Levant ... more details
E1b1 YDNA E1b1 descendants E1b1a1, E1b1a2 mutations L222.1, V38, V100 members In human genetics , Haplogroup E1b1a is a Human Y chromosome DNA haplogroups human Y chromosome DNA haplogroup . It is the phylogenetic term for the series of unique sequence variants on the human Y chromosome . It is often ... Y Chromosome Haplogroup E1b1 E P2 Revealed through the Use of Newly Characterized Binary Polymorphisms ... Genealogy first author link title YDNA Haplogroup E and its Subclades 2010 date 3 February 2010 url ... of the YDNA haplogroups Haplogroup A YDNA A1a , A1b, A2, A3, and Haplogroup B YDNA B M60 ... Neolithic Origin for Y Chromosomal DNA Variation in North Africa journal American Journal ... 1.4 2 139 ref name AlZahery2003 cite journal title Y chromosome and mtDNA polymorphisms in Iraq ... Naidoo cite journal title Development of a single base extension method to resolve Y chromosome haplogroups ... title The imprint of the Slave Trade in an African American population mitochondrial DNA, Y chromosome ... by the singlenucleotide polymorphism SNP mutation M329. ref group Note It was formerly known as E1b1c ... content early 2008 04 02 gr.7172008.abstract cited by accessdate pmc 2336805 ref the ISOGG YDNA ... P268, P269 E1b1a2 M329 YDNA See also Human Y chromosome DNA haplogroup References Reflist 2 Notes ... DEFAULTSORT Haplogroup E1b1a YDna Category Human YDNA haplogroups E1b1a Category Human evolution ... Y chromosomal diversity in the population of Guinea Bissau a multiethnic perspective journal BMC Evolutionary ... ref ref name Semino2004 cite journal title Origin, Diffusion, and Differentiation of Y Chromosome ... Montano2011 cite journal title The Bantu expansion revisited a new analysis of Y chromosome variation ... the pre existing population Y chromosomal diversity in Western, Central, Southern and southern East ... Wood2005 cite journal title Contrasting patterns of Y chromosome and mtDNA variation in Africa evidence ... journal title The phylogeography of Y chromosome binary haplotypes and the origins of modern human ... more details
Encyclopedia
top
