chembox verifiedrevid 407834905 ImageFile1 Guanin.svg ImageSize1 150px ImageFileL2 Guanine 3D balls.png ImageFileR2 Guanine 3D vdW.png ImageSizeL2 120px ImageSizeR2 120px IUPACName 2 amino 1 H purin 6 9 H one OtherNames 2 amino 6 hydroxypurine, br 2 aminohypoxanthine, br Guanine Section1 Chembox Identifiers ... Chembox Related OtherAnions OtherCations OtherCpds Cytosine Adenine Thymine Uracil Guanine G is one ... , cytosine , and thymine uracil in RNA . In DNA , guanine is paired with cytosine. With the formula C sub 5 sub H sub 5 sub N sub 5 sub O, guanine is a derivative of purine , consisting of a fused pyrimidine ... is planar. The guanine nucleoside is called guanosine . Basic principles Guanine, along with adenine ... only in RNA. Guanine has two tautomer ic forms, keto enol tautomerism the major keto form see figures .... Guanine has a group at C 6 that acts as the hydrogen acceptor, while the group at N 1 and the amino ... 325px Image Guannum2.png 250px The first isolation of guanine was reported in 1844 from the excreta ... of Guanine in Extracts of Girella Nigricans journal Proc Natl Acad Sci volume 30 issue ... that uric acid can be converted to guanine. Guanine can be hydrolyzed with strong acid to glycine , ammonia , carbon dioxide , and carbon monoxide . Guanine is first deaminated to xanthine . ref ... pp.htm accessdate 2008 03 27 ref Guanine oxidizes more readily than adenine, the other purine derivative ..., guanine is relatively insoluble in water, but it is soluble in dilute acids and bases. Syntheses Trace amounts of guanine form by the polymerization of ammonium cyanide NH sub 4 sub CN . Two experiments ... at 20 C for 25 years gave a 0.0035 yield. These results indicate guanine could arise in frozen regions of the primitive earth. In 1984, Yuasa reported a 0.00017 yield of guanine after the electrical ..., followed by a subsequent acid hydrolysis. However, it is unknown whether the presence of guanine ... Stanley L. Miller, John Or title Production of Guanine from NH4CN Polymerizations journal Journal ... more details
enzyme Name guanine transporting ATPase EC number 3.6.3.37 CAS number IUBMB EC number 3 6 3 37 GO code 0008558 image width caption In enzymology , a guanine transporting ATPase EC number 3.6.3.37 is an enzyme that catalysis catalyzes the chemical reaction ATP H sub 2 sub O guanineout math rightleftharpoons math ADP phosphate guaninein The 3 substrate biochemistry substrates of this enzyme are adenosine triphosphate ATP , water H sub 2 sub O , and guanine , whereas its 3 product chemistry products are adenosine diphosphate ADP , phosphate , and guanine . This enzyme belongs to the family of hydrolase s, specifically those acting on acid anhydrides to catalyse transmembrane movement of substances. The systematic name of this enzyme class is ATP phosphohydrolase guanine importing . References reflist 1 cite journal author Dreesen TD, Johnson DH, Henikoff S year 1988 title The brown protein of Drosophila melanogaster is similar to the white protein and to components of active transport complexes journal Mol. Cell. Biol. volume 8 pages 5206&ndash 15 pmid 3149712 issue 12 pmc 365623 cite journal author Tearle RG, Belote JM, McKeown M, Baker BS, Howells AJ year 1989 title Cloning and characterization of the scarlet gene of Drosophila melanogaster journal Genetics. volume 122 pages 595&ndash 606 pmid 2503416 issue 3 pmc 1203733 cite journal author Griffiths JK and Sansom CE date title The Transporter Factsbook, Academic Press, San Diego, 1998 journal volume pages Category EC 3.6.3 Category Enzymes of unknown structure hydrolase stub ... more details
reactions class wikitable Substrate Product Notes hypoxanthine inosine monophosphate guanine guanosine ... guanine and phosphoribosyl pyrophosphate PRPP to form Guanosine monophosphate GMP . Role in disease ... of the molecular basis of hypoxanthine guanine phosphoribosyltransferase HPRT deficiency journal Hum ... hypoxanthine guanine phosphoribosyltransferase HPRT deficiency journal Am. J. Hum. Genet. volume ..., Snyder FF title The point mutation of hypoxanthine guanine phosphoribosyltransferase HPRTEdinburgh ... Sculley DG, Dawson PA, Beacham IR, et al. title Hypoxanthine guanine phosphoribosyltransferase deficiency ..., Kelley WN title Molecular basis of hypoxanthine guanine phosphoribosyltransferase deficiency in ten ... guanine phosphoribosyltransferase HPRT Ann Arbor journal Hum. Genet. volume 79 issue 1 pages 39 ... WN, Palella TD title Human hypoxanthine guanine phosphoribosyltransferase deficiency. The molecular ... Identification of a single nucleotide change in the hypoxanthine guanine phosphoribosyltransferase ... more details
File GTP.png thumb GTP File GDP chemical structure.png thumb GDP Guanine nucleotide exchange factors GEFs are components of intracellular cell signalling signalling networks that stimulate the release of Guanosine diphosphate GDP which is replaced by Guanosine triphosphate GTP . ref name Alberts et al 2002 cite book author Bruce Alberts et al title Molecular Biology of the Cell url http www.ncbi.nlm.nih.gov books NBK26822 A2855 accessdate 12 January 2011 year 2002 publisher Garland Science isbn 081533218 pages 877 ref Guanine nucleotide exchange factors GEFs stimulate the exchange of GDP for GTP to generate the activated form, which is then capable of recognizing downstream targets, or effector proteins. GTPase activating proteins GAPs accelerate the intrinsic GTPase activity of Rho family members to inactivate the switch . ref http www.cellbio.wustl.edu education bio5068 Articles Hall 20GEF 20review.pdf ref They function as activators of small GTPases ref name pmid17934073 cite journal author Coburn B, Sekirov I, Finlay BB title Type III secretion systems and disease journal Clin. Microbiol. Rev. volume 20 issue 4 pages 535 49 year 2007 month October pmid 17934073 pmc 2176049 doi 10.1128 CMR.00013 07 url ref see Nucleotide exchange factor . G proteins function as molecular switches, where the resting inactive state they are bound to Guanosine diphosphate GDP and their activation requires the dissociation of GDP and binding of guanosine triphosphate GTP , which exists at an approximate 10 fold higher concentration in the cell cytoplasm. GEFs activate G proteins by promoting this nucleotide exchange. The hundreds of GEFs described thus far exhibit varying degrees of specificity with some being able to activate multiple G proteins of different families and others only able ... GNOM Arabidopsis thaliana References reflist See also nucleotide exchange factor guanine small GTPases G proteins GTP binding protein regulators DEFAULTSORT Guanine Nucleotide Exchange Factor Category ... more details
A phosphoribosyltransferase is a type of transferase enzyme. Types include Adenine phosphoribosyltransferase Hypoxanthine guanine phosphoribosyltransferase Orotidine 5 phosphate decarboxylase Uracil phosphoribosyltransferase Glycosyltransferases Category Transferases enzyme stub ... more details
GNE can refer to The later name of GNUPedia GNE is Not an Encyclopedia Game Neverending , a massively multiplayer computer game The .gne file extension, used by Flickr , is derived from Game Neverending GNE gene , a human gene Go North East , a bus operator in North East England Guanine nucleotide exchange factor Guanine Nucleotide Exchange biology disambig de GNE it GNE ... more details
M349 Guanine G to Thymine T 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct M356 M359 Thymine T to Cytosine C 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt M365 Adenine A to Guanine G 246 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M367 Adenine A to Guanine G 196 274 ccttcatttaggctgtagctgc ... M369 Guanine G to Cytosine C 45 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M370 Cytosine C to Guanine G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M405 See also Single nucleotide polymorphism ... more details
A base analog is a chemical that can substitute for a normal nucleobase in nucleic acid s. A common example would be 5 bromouracil 5BU , the abnormal base found in the mutagenic nucleotide analog BrdU. When a nucleotide containing 5 bromouracil is incorporated into the DNA, it is most likely to pair with adenine however, it can spontaneously shift into another isomer which pairs with a different nucleobase , guanine . If this happens during DNA replication, a guanine will be inserted opposite the base analog, and in the next DNA replication, that guanine will pair with a cytosine. This results in a change in one base pair of DNA, specifically a Transition genetics transition mutation . Image 5bu 2.gif center thumb 500px Mutagenesis by 5BU See also Antimetabolite References Griffiths AJ, Wessler SR, Lewontin RC, Gelbart WM, Suzuki DT, Miller JH. Introduction to Genetic Analysis , 8th ed. New York W.H.Freeman and Co, 2005. Category DNA Category Genetics de Basenanaloga zh ... more details
from rabbit erythrocytes catalyzing the insertion of guanine into tRNA journal J. Biol. Chem. volume ... N, Ohgi T, Goto T, Nishimura S date 1980 title Transfer ribonucleic acid guanine transglycosylase isolated ... more details
Pentosyltransferases are a type of glycosyltransferase that catalyze the transfer of a pentose . Examples include adenine phosphoribosyltransferase hypoxanthine guanine phosphoribosyltransferase pertussis toxin poly ADP ribose polymerase They are classified under EC number 2.4.2. External links MeshName Pentosyltransferases Glycosyltransferases enzyme stub Category EC 2.4.2 ... more details
DISPLAYTITLE C sub 5 sub H sub 5 sub N sub 5 sub O The molecular formula C sub 5 sub H sub 5 sub N sub 5 sub O molar mass 151.13 g mol may refer to Guanine Isoguanine MolFormDisambig ... more details
Inosine 5 monophosphate dehydrogenase IMPDH is an enzyme which salvages purine s to make guanine in the human pathogen Cryptosporidium parvum . The C. parvum enzyme IMPDH differs enough from human IMPDH to serve as a drug target. Chem. Biol. 15, 70 2008 Category Enzymes enzyme stub ... more details
The Guanosine nucleotide dissociation inhibitors GDIs , bind to the GDP bound form of Rho and Rab small GTPase s and not only prevent exchange maintaining the small GTPase in an off state , but also prevent the small GTPase from localizing at the membrane, which is their place of action. This inhibition can be removed by the action of a Guanine nucleotide exchange factor GEF . External links MeshName Guanine Nucleotide Dissociation Inhibitors Category GTP binding protein regulators GTP binding protein regulators biochem stub DEFAULTSORT Guanosine Nucleotide Dissociation Inhibitors sr Inhibitori disocijacije guanozin nukleotida ... more details
O sup 6 sup alkyl guanine transferase II O sup 6 sup AGT II previously known as O sup 6 sup Guanine transferase ogt is a protein that is involved in DNA repair with Ada protein Ada . ref name Friedberg cite book title DNA Repair and Mutagenesis edition 2 last Friedberg first Errol authorlink coauthors Graham C. Walker, Wolfram Siede, Richard D. Wood , Roger A. Schultz, Tom Ellenberger year 2006 publisher ASM Press location Washington, DC isbn 1 55581 319 4 OCLC 59360087 pages ref Like Ada, AGT II is responsible for the removal of alkyl groups from O sup 6 sup alkyl guanine , O sup 4 sup alkyl thymine and alkyl phosphotriester in the sugar phosphate backbone of DNA. ref name Friedberg AGT II shows a greater preference for O sup 4 sup alkyl thymine than O sup 6 sup alkyl guanine and alkyl phosphotriester. ref name Friedberg ref name Sassanfar Sassanfar M, Dosanjh MK, Essigmann JM, Samson L. Relative efficiencies of the bacterial, yeast, and human DNA methyltransferases for the repair of O sup 6 sup methylguanine and O sup 4 sup methylthymine. Suggestive evidence for O sup 4 sup methylthymine repair by eukaryotic methyltransferases. J Biol Chem. 1991 Feb 15 266 5 2767 71. PMID 1993655. ref Unlike Ada, AGT II is expressed constitutively in cells. ref name Friedberg ref name Rebeck Rebeck GW, Samson L. Increased spontaneous mutation and alkylation sensitivity of Escherichia coli strains lacking the ogt O6 methylguanine DNA repair methyltransferase. J Bacteriol. 1991 Mar 173 6 2068 76. PMID 2002008. ref Therefore, AGT II will repair alkylated DNA adduct s even before Ada is fully induced. AGT II is similar to Ada in its Suicide inhibition suicide inactivation in that AGT II transfers the alkyl group to a cysteine residue in its own structure, thereby inactivating itself. ref name Friedberg The human equivalent of AGT II is MGMT O sup 6 sup methyl guanine methyl transferase . MGMT preferentially removes alkyl groups from O sup 6 sup alkyl guanine than from O sup 4 sup alkyl ... more details
GRR or grr may refer to ANOVA Gage R&R , Gage Repeatability and Reproducibility, a statistical measure of the precision of a measurement system Great River Road , a series of roads which follow the Mississippi River Gerald R. Ford International Airport , IATA code GRR, in Grand Rapids, Michigan Grand Rapids Amtrak station , station code GRR, in Grand Rapids, Michigan Agroar Trabalhos A reos , ICAO airline code GRR, based in Portugal The Taznatit language, ISO 639 3 code Glycine rich region, a stretch of a protein containing multiple copies of the amino acid glycine Guanine rich region, a stretch of DNA containing multiple copies of the nucleotide guanine Grr, an onomatopoeia for growling , also spelled grrr See also Grrr disambig de GRR fr GRR it GRR ... more details
GEF or Gef may refer to Gef the talking mongoose , a famed poltergeist story from the Isle of Man Global Electronics Forum Global Environment Facility Graphical Editing Framework Guanine nucleotide exchange factor , activators of G proteins Green European Institute , The foundation of the European Green Party. The letters stand for Green European Foundation. disambig de GEF fr GEF it GEF sr GEF ... more details
A salvage pathway is a Metabolic pathway pathway in which nucleotide s purine and pyrimidine are synthesized from intermediates in the degradative pathway for nucleotides. Salvage pathways are used to recover bases and nucleosides that are formed during biodegradation degradation of RNA and DNA . This is important in some organs because some tissues cannot undergo de novo synthesis . The salvaged bases and nucleosides can then be converted back into nucleotides. Substrates The salvage pathway requires distinct substrates Pyrimidines Uridine phosphorylase adds ribose 1 phospate to the free base uracil, forming uridine monophosphate. Uridine kinase then phosphorylates this nucleoside into its diphosphate and triphosphate forms. Deoxythymidine phosphorylase adds deoxyribose 1 phosphate to thymine, forming deoxythymidine monophosphate. Thymidine kinase can then phosphorylate this compound to deoxythymidine diphosphate and triphosphate. Purines Phosphoribosyltransferases add activated ribose 5 phosphate called phosphoribosyl pyrophosphate or PRPP to bases, creating nucleotide monophosphates. There are two types of phosphoribosyltransferases adenosine phosphoribosyltransferase APRT and hypoxanthine guanine phosphoribosyltransferase HGPRT . Lesch Nyhan syndrome is associated with a deficiency of HGPRT. class wikitable Nucleoside Enzyme Nucleotide hypoxanthine hypoxanthine guanine phosphoribosyl transferase HGPRT Inosine monophosphate IMP guanine hypoxanthine guanine phosphoribosyl transferase HGPRT Guanosine monophosphate GMP adenine adenine phosphoribosyltransferase APRT Adenosine monophosphate AMP External links http www.chem.brandeis.edu pochapsky research.html Enzymes in the methionine salvage pathway structure and function at Brandeis University Category Genetics genetics stub Protein metabolism Nucleotide metabolism ca Salvament de nucle tids de Salvage Pathway ja zh ... more details
High GC content bacteria are Gram positive bacteria with a high number of guanine and cytosine bases as compared to adenine and thymine . These bacteria are of the class Actinobacteria ref NCBI Taxonomy browser, http www.ncbi.nlm.nih.gov Taxonomy Browser wwwtax.cgi?mode Undef&id 201174&lvl 3&lin f&keep 1&srchmode 1&unlock, accessed 3 13 07. ref . For more information, see GC content . References references bacteria stub Category Microbiology ... more details
FYVE, RhoGEF and PH domain containing FGD is a gene family consisting of FGD1 FGD2 FGD3 FGD4 Type 1 is associated with Aarskog Scott syndrome . See also Guanine nucleotide exchange factor External links MeshName FGD1 protein, human MeshName FGD2 protein, human Category Genes biochem stub GTP binding protein regulators ... more details
Vav is a family of proteins involved in cell signalling . They act as guanine nucleotide exchange factors GEFs for small G protein s of the Rho family . GEF activity is mediated via module of tandem RhoGEF domain DH PH domain PH domains. Vav proteins also appear to exhibit GEF independent functions. There are three members of this family VAV1 Vav1 VAV2 Vav2 VAV3 Vav3 protein stub Category Protein families de Vav Proteine ... more details
EF Ts elongation factor thermo stable is one of the prokaryotic elongation factors . EF Ts serves as the guanine nucleotide exchange factor for EF Tu elongation factor thermo unstable , catalyzing the release of guanosine diphosphate from EF Tu. This enables EF Tu to bind to a new guanosine triphosphate molecule, release EF Ts, and go on to catalyze another aminoacyl tRNA addition. GeneticTranslation Category Protein biosynthesis enzyme stub ... more details
Encyclopedia
top
