Refimprove date February 2007 enzyme Name DNAligase EC number 6.5.1.1 CAS number 9015 85 4 IUBMB EC number 6 5 1 1 GO code 0003910 image DNA Ligase.jpg width caption DNAligase I protein Name ligase I ... Name ligase III, DNA, ATP dependent caption image width HGNCid 6600 Symbol LIG3 AltSymbols EntrezGene ... LocusSupplementaryData q12 protein Name ligase IV, DNA, ATP dependent caption image width HGNCid 6601 ... 13 Arm q Band 33 LocusSupplementaryData q34 In molecular biology , DNAligase is a special ... a break in both complementary strands of DNA . Purified DNAligase is used in gene cloning to join DNA ... type of DNAligase using the Complementary DNA complementary strand as a template Citation needed date April 2010 but still requires DNAligase to create the final phosphodiester bond to fully repair the DNA. DNAligase has applications in both DNA repair and DNA replication see DNAligase Mammalian ligases Mammalian ligases . In addition, DNAligase has extensive use in molecular biology laboratories for Genetic recombination experiments see DNAligase Applications in molecular biology research Applications in molecular biology research . Ligase mechanism The mechanism of DNAligase is to form ... and the 3 hydroxyl of the acceptor. ref name pmid4377758 cite journal author Lehman IR title DNAligase ... a ligase works with DNA end sticky end s Image Ligation.svg 400px Ligase will also work with DNA end ... ligases This section is linked from DNAligase In mammals, there are four specific types of ligase. LIG1 DNAligase I ligates the nascent DNA of the Replication fork Lagging strand lagging strand after the DNA polymerase I has removed the RNA primer from the Okazaki fragment s. DNAligase II alternatively RNA splicing splice d form of DNAligase III found in non dividing cells. DNAligase ... of DNA repair nucleotide excision repair and recombinant fragments. LIG4 DNAligase IV complexes ... and T cell receptor loci during immune system development. Some forms of DNAligase ... more details
about general ligases DNA specific ligases DNAligase In biochemistry , ligase from the Latin language Latin verb lig re &mdash to bind or to glue together is an enzyme that can catalyse the joining of two large molecules by forming a new chemical bond , usually with accompanying hydrolysis of a small chemical group dependant to one of the larger molecules. In general, ligase catalyzes the following reaction Ab C A&ndash C b or sometimes Ab cD A&ndash D b c where the lowercase letters signify the small, dependent groups. Nomenclature The common names of ligase enzymes often include the word ligase, such as DNAligase , an enzyme commonly used in molecular biology laboratory laboratories to join together DNA fragments. Other common names for ligases include synthetases , because they are used to Biosynthesis synthesize new molecules. Note that, originally, biochemical nomenclature distinguished synthetases and synthase s. Under the original definition, synthases do not use energy from nucleoside triphosphates such as ATP, GTP, CTP, TTP, and UTP , whereas synthetases do use nucleoside triphosphates. However, the Joint Commission on Biochemical Nomenclature JCBN dictates that synthase can be used with any enzyme that catalyses synthesis whether or not it uses nucleoside triphosphates , whereas synthetase is to be used synonymously with ligase . ref http www.chem.qmul.ac.uk iubmb newsletter misc synthase.html ref Classification Ligases are classified as EC 6 in the EC number classification of enzymes. Ligases can be further classified into six subclasses Category EC 6.1 EC 6.1 includes ligases used to form carbon oxygen bonds Category EC 6.2 EC 6.2 includes ligases used to form ... EC 6.6 includes ligases used to form nitrogen metal bonds See also DNAligase References references ... da Ligase de Ligase es Ligasa fr Ligase id Ligase it Ligasi he lt Ligaz s nl Ligase no Ligase ja pl Ligazy pt Ligase ru sv Ligas tr Ligaz ur uk zh ... more details
segments called Okazaki fragment s before DNAligase joins them together. Replication Further ...File DNA Structure Key Labelled.png thumb right 340px The structure of the DNA double helix . The atoms ... ADN animation.gif thumb The structure of part of a DNA double helix Deoxyribonucleic acid IPA en di ksi ra b .nju kle . k s d en us Deoxyribonucleic acid.ogg , or DNA , is a nucleic acid that contains ... organism s with the exception of RNA virus es . The main role of DNA molecule s is the long term storage of information . DNA is often compared to a set of blueprint s, like a recipe or a code, since ... s and RNA molecules. The DNA segments that carry this genetic information are called gene s, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. DNA consists of two long polymers of simple units called nucleotide s, with backbone ... is read by copying stretches of DNA into the related nucleic acid RNA, in a process called transcription genetics transcription . Within cells, DNA is organized into long structures called chromosome s. These chromosomes are duplicated before cells cell division divide , in a process called DNA ... most of their DNA inside the cell nucleus and some of their DNA in organelle s, such as mitochondria ... store their DNA only in the cytoplasm . Within the chromosomes, chromatin proteins such as histone s compact and organize DNA. These compact structures guide the interactions between DNA and other proteins, helping control which parts of the DNA are transcribed. Properties File DNA chemical structure.svg thumb 300px Chemical structure of DNA. Hydrogen bond s shown as dotted lines. DNA is a long polymer ... 57023651 69932405 ref ref name Butler cite book author Butler, John M. year 2001 title Forensic DNA ... by James D. Watson and Francis Crick , the structure of DNA of all species comprises two helical ... solution, the DNA chain measured 22 to 26 ngstr m s wide 2.2 to 2.6 nanometre s , and one ... more details
Image A DNA orbit animated small.gif right frame The A DNA structure. A DNA is one of the many possible double helical structures of DNA . A DNA is thought to be one of three biologically active double helical structures along with B DNA B and Z DNA . It is a right handed double helix fairly similar to the more common and well known B DNA form, but with a shorter more compact helical structure. It appears likely that it occurs only in dehydrated samples of DNA, such as those used in crystallographic experiments, and possibly is also assumed by DNA RNA hybrid helices and by regions of double stranded RNA. Structure A DNA is fairly similar to B DNA given that it is a right handed double helix with major ... turn. This results in a deepening of the major groove and a shallowing of the minor. Predicting A DNA structure An algorithm for predicting the propensity of a sequence to flip from B DNA to A DNA ... cite journal author Basham B, Schroth GP, Ho PS title An A DNA triplet code thermodynamic rules for predicting A and B DNA journal Proc Natl Acad Sci USA volume 92 issue 14 pages 6464 6468 year ... in the hydration of DNA surfaces can be used to distinguish between sequences that form A and B DNA. From this, a triplet code of A DNA propensities was derived as energetic rules for predicting A DNA formation. This code correctly predicted 90 of A and B DNA sequences in crystals and correlates with A DNA formation in solution. Thus, with our previous studies on Z DNA, we now have a single method to predict the relative stability of sequences in the three standard DNA duplex conformations. ref name Basham1995 cite journal author Basham B, Schroth GP, Ho PS title An A DNA triplet code thermodynamic rules for predicting A and B DNA journal Proc Natl Acad Sci USA volume 92 issue 14 pages ... of the Most Common DNA Forms Image A DNA, B DNA and Z DNA.png right thumb Side view of A , B , and Z DNA. Image B&Z&A DNA formula.jpg thumb right 250px The helix axis of A , B , and Z DNA. class ... more details
Infobox animanga Header name DNA image caption ja kanji D N A ja romaji D En Ei Ts Dokoka de Nakushita Aitsu no Aitsu genre Harem genre Harem , Science fiction Infobox animanga Print type manga author Masakazu Katsura publisher Shueisha publisher other flagicon FRA Editions Tonkam br flagicon GER Carlsen Comics br flagicon MEX Grupo Editorial Vid br flagicon ESP Planeta DeAgostini Comics br flagicon BRA Editora JBC demographic Sh nen manga Sh nen magazine Weekly Sh nen Jump first 1993 last 1994 volumes 5 volume list Infobox animanga Video type tv series director Jun ichi Sakata producer writer music studio Madhouse company Madhouse br Studio Deen network Animax , Nippon Television network other flagicon KOR Animax first 7 October 1994 last 23 December 1994 episodes 12 episode list Infobox animanga Video type ova director Jun ichi Sakata producer writer music studio Madhouse company Madhouse br Studio Deen released 1995 runtime episodes 3 episode list Infobox animanga Footer nihongo DNA D N A D En Ei Ts Dokoka de Nakushita Aitsu no Aitsu is a science ... 100 children that carry the Mega Playboy DNA, causing them and all their descendants to each have 100 ... to deal with. Karin reveals to Junta that she is a DNA Operator . Her job is to make alterations in people s DNA that will change their nature for the greater good of society. She intends to shoot the original Mega Playboy with a DCM DNA Control Medicine bullet that will alter his DNA in order ... DCM bullet. However, each time he transforms, his Mega Playboy DNA stabilizes more and more. nihongo Karin Aoi Aoi Karin anime voices Miina Tominaga Jessica Calvello A sixteen year old DNA ... Never Forget You Manga The DNA manga was published in Japanese magazine Weekly Sh nen Jump 1993 No. 36 ... es ca DNA cs DNA de DNA es DNA fr DNA ko DNA id DNA it DNA ja D N A pt DNA ru DNA fi DNA sv DNA tl DNA zh DNA ... more details
enzyme Name Ubiquitin protein ligase EC number 6.3.2.19 CAS number 74812 49 0 IUBMB EC number 6 3 2 19 GO code 0051444 image width caption A ubiquitin ligase also called an E3 ubiquitin ligase is a protein that in combination with an E2 ubiquitin conjugating enzyme causes the attachment of ubiquitin to a lysine on a target protein via an isopeptide bond the E3 ubiquitin ligase targets specific protein substrates for degradation by the proteasome . In general, the ubiquitin ligase is involved in polyubiquitination A second ubiquitin is attached to the first, a third is attached to the second, and so forth. Polyubiquitination marks proteins for degradation by the proteasome. However, there are some ubiquitination events that are limited to mono ubiquitination, in which only a single ubiquitin is added by the ubiquitin ligase to a substrate molecule. Mono ubiquitinated proteins are not targeted to the proteasome for degradation, but may instead be altered in their cellular location or function ... for DNA repair, amongst other functions. Overview In enzymology , an ubiquitin protein ligase EC number 6.3.2.19 is an enzyme that catalysis catalyzes the chemical reaction ATP ubiquitin ... N ubiquityllysine . This enzyme belongs to the family of ligase s, specifically those forming ... class is ubiquitin protein lysine N ligase AMP forming . This enzyme is also called ubiquitin ... , and PDB link 2Z6P . Ubiquitination system The ubiquitin ligase is referred to as an E3, and operates ... of the ubiquitylation system. gallery Ubiquitin ligase families The anaphase promoting complex APC and the SCF complex Skp1 Cullin F box protein complex are two examples of ubiquitin ligase protein .... This wide variety has been discovered to fall into specific groups called ubiquitin ligase families ... from the E2 to the substrate. Individual E3 ubiquitin ligases Ubiquitin protein ligase E3A E3A mdm2 ... DEFAULTSORT Ubiquitin Ligase Category EC 6.3 Category Posttranslational modification ru ... more details
Image Figure 2d.200.jpg The L1 Ligase Ribozyme 2.6 crystal structure right thumb 200px The RNA Ligase ribozyme was the first of several types of Ribozyme Synthetic ribozymes synthetic ribozymes produced by in vitro evolution and selection techniques. They are an important class of ribozymes because they catalyze the assembly of RNA fragments into phosphodiester RNA polymers, a reaction required of all extant nucleic acid polymerases and thought to be required for any self replicating molecule. Ideas that the origin of life may have involved the first self replicating molecules being ribozymes are called RNA World RNA World hypotheses . Ligase ribozymes may have been part of such a pre biotic RNA world. In order to copy RNA, fragments or monomers individual building blocks that have Nucleotide 5 triphosphates must be ligated together. This is true for modern protein based Rna Polymerase polymerases , and is also the most likely mechanism by which a ribozyme self replicase in an RNA world might function. Yet no one has found a natural ribozyme that can perform this reaction. In vitro evolution and selection RNA Directed evolution in vitro evolution or Systematic Evolution of Ligands by Exponential Enrichment SELEX enables the artificial evolution and selection of RNA molecules that possess a desired property, such as binding affinity for a particular ligand or an activity such as that of an enzyme ... ribozyme. The L1 ligase Michael Robertson and Andrew Ellington evolved a ligase ribozyme that performs the desired Phosphodiester bonds 5 3 RNA assembly reaction, and called this the L1 ligase ... and optimality of a short ribozyme ligase that joins non Watson Crick base pairings journal RNA ... of the L1 ligase molecular switch journal RNA volume 16 issue 4 pages 769 80 year 2010 month April pmid ... JN, Ferr D Amar AR title Structure guided engineering of the regioselectivity of RNA ligase ribozymes ... year 2000 month April pmid 10734194 pmc 102822 doi url ref div reflist 1 DEFAULTSORT Ligase Ribozyme ... more details
to develop symptoms at a much younger age. Interactions Parkin ligase has been shown to Protein ... for familial Parkinson s disease, and enhances its ubiquitin ligase activity journal Mol. Cell ... ligase complex and protects postmitotic neurons from kainate excitotoxicity journal Neuron volume ... more details
DNA shuffling is a way to rapidly propagate beneficial mutation s in a directed evolution experiment. It is used to rapidly increase DNA library size. ref http www.sciencemag.org cgi content full 293 5528 237?ijkey MAy6Zxe5PJ3u2&keytype ref&siteid sci Science AAAS Science Magazine Sign In Bot generated title ref Procedure DNAse I is first used to fragment a set of parent gene s into pieces of 50 100 base pair bp in length. This is then followed by a polymerase chain reaction PCR without primers DNA fragments with sufficient overlapping homologous sequence will anneal to each other and are then extended by DNA polymerase . Several rounds of this PCR extension are allowed to occur, after some of the DNA molecules reach the size of the parental genes. These genes can then be amplified with another PCR, this time with the addition of Primer molecular biology primers that are designed to complement the ends of the strands. The primers may have additional sequences added to their 5 ends, such as sequences for restriction enzyme recognition sites needed for ligation into a cloning vector. It is possible to recombination recombine portion of these genes to generate hybrids or Chimera genetics chimeric forms with unique properties, this is called DNA shuffling. Shuffling methods Restriction enzymes Restriction enzyme s that cut in similar places are used to digest members of the gene family DNA fragments are joined together with DNAligase Large numbers of hybrid biology hybrids are produced which can be tested for unique properties DNase 1 Different members of the gene family are fragmented using DNase 1 followed by PCR During PCR different members of the family are cross primed, DNA ... generate a DNA library library of mutants which are tested for unique properties See also SCOPE protein engineering RACHITT Homologous recombination References references DEFAULTSORT Dna Shuffling Category DNA biochem stub genetics stub molecular biology stub es Barajado de ADN ... more details
Onesource date June 2009 DNA end or sticky end refers to the properties of the end of a molecule of DNA or a recombinant DNA molecule. The concept is important in molecular biology , especially in Clone genetics cloning or when subcloning inserts DNA into vector DNA. All the terms can also be used in reference ... ends can anneal, even those from two different organisms. This bondage is temporary however, and DNAligase will eventually form a covalent bond between the sugar phosphate residue of adjacent nucleotides to join the two molecules together. Single stranded DNA molecules A single stranded non circular DNA molecule has two non identical ends, Directionality molecular biology the 3 end and the 5 end ... atoms in the deoxyribose , which is a sugar forming an important part of the backbone of the DNA molecule. In the backbone of DNA the 5 carbon of one deoxyribose is linked to the 3 carbon of another ..., and so forth. Variations in double stranded molecules When a molecule of DNA is double stranded, as DNA ... DNA end of a double stranded molecule is called a blunt end . In a blunt ended molecule both strands terminate in a base pair . Blunt ends are not always desired in biotechnology since when using a DNAligase to join two molecules into one, the yield is significantly lower with blunt ends. When performing subcloning, it also has the disadvantage of potentially inserting the insert DNA in the opposite ... is an example of a small piece of blunt ended DNA 5 font color red CTGATCTGACTGATGCGTATGCTAGT font ... by various overhangs . An overhang is a stretch of unpaired nucleotide s in the end of a DNA molecule ... often adenosine and is created as a 3 overhang by some DNA polymerase s. Most commonly this is used in cloning PCR products created by such an enzyme. The product is joined with a linear DNA ... the joining of the two molecules by a ligase, yielding a circular molecule. Here is an example of an A overhang ... they cut DNA. Very often they cut the two DNA strands four base pairs from each other, creating a four ... more details
blunt ends via the enzyme, T4 Ligase. When recombinant DNA is then further altered or changed to host additional strands of DNA, the molecule formed is referred to as chimeric DNA molecule, ref name ...Recombinant DNA rDNA is a form of artificial DNA that is created by combining two or more Nucleic acid ... oclc ref In terms of genetic modification , it is created through the introduction of relevant DNA into an existing organismal DNA, such as the plasmid s of bacteria , to code for or alter different traits ... isbn0 7167 8724 5 A recombinant protein is a protein that is produced from recombinant DNA. ref ... DNA in classical biology, as the term clone refers to a cell or organism derived from a parental ..., the use of recombinant DNA provides the initial cell from which the host organism is then expected ... due to the use of viral vector s in medicine that contain recombinant DNA inserted into a structure ... forms of DNA present in most bacteria, such as Escherichia coli E. Coli , containing genes related ... the attachment of a selected segment of DNA, which codes for more reparative substances, such as peptide ... to reproduce so as to recapitulate the altered DNA within other cells it infects, and increase the amount of cells with the recombinant DNA present within them. The use of plasmids is also key within ... of transporting and passing on genes in recombinant DNA through viral reproduction throughout an organism ... to allow identification of successfully recombined DNA. ref name isbn0 7167 8724 5 The cloning ... foreign DNA into the genomes of many plants. Other methods of introducing or creating recombinant DNA in eukaryotes include homologous recombination and transfection with modified viruses . Chimeric ... and bacterial cells that all contain copies of the original chimeric DNA. ref name isbn0 7167 8724 ..., ref name isbn0 7167 8724 5 as the intended outcome of the addition of foreign DNA may not always ... DNA strands to single stranded overhangs ref name isbn0 7167 8724 5 or sticky ends present at the ends ... more details
. Ligase works to fill these nicks in, thus completing the newly replicated DNA molecule. As DNA synthesis ... different kinds of nucleotides . DNAligase joins the fragments together. Dynamics at the replication ...Merge from Replication fork discuss Talk DNA replication Merge from Replication fork date May 2009 Image DNA replication split.svg thumb 200px right DNA replication. The double helix is unwound and each strand acts as a template. Nucleotides Bases are matched to synthesize the new partner strands. DNA replication is a biological process that occurs in all life on Earth living organisms and copies their DNA ... DNA molecule and produces two identical copies of the molecule. Each strand of the original double stranded DNA molecule serves as template for the production of the complementary strand. Cellular ... fidelity for DNA replication. ref cite book author Berg JM, Tymoczko JL, Stryer L, Clarke ND title ... books bv.fc,kgi?rid stryer.chapter.3740 Chapter 27 DNA Replication, Recombination, and Repair ref ... bv.fcgi?rid mboc4.chapter.747 Chapter 5 DNA Replication, Repair, and Recombination ref In a cell biology cell , DNA replication begins at specific locations in the genome, called origin of replication ... bofghoks bv.fcvbngi?rid stryer.section.3794 Chapter 27, Section 4 DNA Replication of Both Strands Proceeds Rapidly from Specific Start Sites ref Unwinding of DNA at the origin, and synthesis of new strands, forms a replication fork . In addition to DNA polymerase , the enzyme that synthesizes the new DNA by adding nucleotides matched to the template strand, a number of other protein s are associated with the fork and assist in the initiation and continuation of DNA synthesis. DNA replication can also be performed in vitro artificially, outside a cell . DNA polymerases , isolated from cells, and artificial DNA primers are used to initiate DNA synthesis at known sequences in a template molecule ... in a cyclic manner to amplify a specific target DNA fragment from a pool of DNA. DNA structure Main ... more details
part is then resynthesized by a DNA polymerase , and a DNAligase performs the final nick sealing ... acharya ref name Bjorksten Image DNA Repair.jpg thumb 230px DNAligase, shown above repairing chromosomal ..., DNALigase IV , a specialized DNAligase that forms a complex with the cofactor XRCC4 , directly ... MR title Yeast DNAligase IV mediates non homologous DNA end joining. journal Nature volume 388 ...pp move indef for the journal DNA Repair journal Image brokechromo.jpg frame right DNA damage resulting in multiple broken chromosomes DNA repair refers to a collection of processes by which a cell biology cell identifies and corrects damage to the DNA molecules that encode its genome . In human cells ... can cause DNA damage, resulting in as many as 1 million individual molecular lesion s per cell per ... cause structural damage to the DNA molecule and can alter or eliminate the cell s ability to Transcription genetics transcribe the gene that the affected DNA encodes. Other lesions induce ... after it undergoes mitosis . As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. When normal repair processes fail, and when cellular apoptosis does not occur, irreparable DNA damage may occur, including double strand breaks and DNA crosslinkages ... The rate of DNA repair is dependent on many factors, including the cell type, the age of the cell, and the extracellular environment. A cell that has accumulated a large amount of DNA damage, or one that no longer effectively repairs damage incurred to its DNA, can enter one of three possible states ... ous The DNA repair ability of a cell is vital to the integrity of its genome and thus to its normal ... life span have turned out to be involved in DNA damage repair and protection. ref name browner ... of evolution . DNA damage DNA damage, due to environmental factors and normal metabolism metabolic ... formation. The vast majority of DNA damage affects the primary structure of the double helix that is, the bases ... more details
DNADNA hybridization generally refers to a molecular biology technique that measures the degree of genetic similarity between pools of DNA sequences. It is usually used to determine the genetic distance between two species . When several species are compared that way, the similarity values allow the species to be arranged in a phylogenetic tree it is therefore one possible approach to carrying out molecular systematics . Charles Sibley and Jon Ahlquist , pioneers of the technique, used DNADNA hybridization to examine the phylogenetic relationships of avians the Sibley Ahlquist taxonomy and primates. ref http evolution.berkeley.edu evolibrary article 0 history 26 Genetic Similarities Wilson, Sarich, Sibley, and Ahlquist ref ref cite journal title The Phylogeny of the Hominoid Primates, as Indicated by DNADNA Hybridization author C.G. Sibley and J.E. Ahlquist journal Journal of Molecular ... DNA hybridization in the apes Technical issues ref DNA sequencing and computational comparisons ... DNADNA hybridization to study complex microbial ecosystems author S.S. Socransky, A.D. Haffajee ... The DNA of one organism is labeled, then mixed with the unlabeled DNA to be compared against. The mixture is incubated to allow DNA strands to dissociate and reanneal, forming hybrid double stranded DNA ..., a process known as DNA melting . To assess the melting profile of the hybridized DNA, the double stranded DNA is bound to a column and the mixture is heated in small steps. At each step, the column ... labeled DNA comes off the column reflects the amount of similarity between sequences and the self ... . Fundamentals of Molecular Evolution. a good text on these topics See also DNA melting Temperature gradient gel electrophoresis Category Molecular biology Category DNA fr Hybridation de l ADN hu DNS DNS hibridiz ci nl DNADNA hybridisatie ja DNADNA pt Hibridiza o de DNADNA sv DNADNA hybridisering tr DNADNA hibridizasyon ... more details
Ask DNA could be Ask DNA album Ask DNA album , the soundtrack to Cowboy Bebop The Movie Ask DNA song Ask DNA song , the theme song to the aforementioned film disambig ... more details
demonstrations of DNA polyhedra involved multiple DNAligase ligations and solid phase synthesis ...Image DNA tetrahedron white.png thumb right 275px DNA nanotechnology seeks to make artificial, Nucleic acid design designed nanostructures out of nucleic acids , such as this DNA tetrahedron described in Goodman, 2005. ref name Goodman05 Each edge of the tetrahedron is a 20 base pair DNA Nucleic acid double helix double helix , and each vertex is a three arm junction. DNA nanotechnology is a branch of nanotechnology which uses the molecular recognition properties of DNA and other nucleic acid s to create designed, artificial structures out of DNA for technological purposes. In this field, DNA is used ... of bionanotechnology . DNA nanotechnology has applications in molecular self assembly and in DNA computing . Although DNA is usually considered in the context of molecular biology as the carrier of Genetics genetic information in living Cell biology cells , DNA nanotechnology considers DNA solely as a chemical and as a material, and is usually pursued outside of any biological context. DNA nanotechnology ... to each other to form Nucleic acid double helix duplex DNA. DNA nanotechnology attempts to Nucleic acid design rationally design sets of DNA strands so that desired portions of each strand will assemble ... DNA nanotechnology, its principles apply equally well to other nucleic acids such as RNA and Peptide ... schematic.png thumb 250px These four strands associate into a DNA four arm junction because ... 2.jpg thumb 250px A double crossover DX molecule. This molecule consists of five DNA single strands ... of Complexity Lessons from DNA journal PLoS Biology volume 2 issue 12 pages 2036 2038 issn 1544 9173 pmid 15597116 pmc 535573 doi 10.1371 journal.pbio.0020431 ref DNA nanotechnology creates ... of nucleotide s, distinguished by which nucleobase they contain. In DNA, the four bases used are adenine ... of DNA nanotechnology in that sequences are Nucleic acid design rationally designed so that a desired ... more details
. Oligonucleotides are annealed and ligated the preferential ligation by DNAligase for matching ...pp move indef small yes Genetics2 The term DNA sequencing is commonly applied to several methods and technologies ... , and thymine in a molecule of DNA . Knowledge of DNA sequences has become indispensable for basic biological research, other research branches utilizing DNA sequencing, and in numerous applied ... of DNA sequencing has significantly accelerated biological research and discovery. The rapid speed of sequencing attained with modern DNA sequencing technology has been instrumental in the sequencing ... across continents, have generated the complete DNA sequences of many animal, plant, and microbial genomes. The first DNA sequences were obtained in the early 1970s by academic researchers using laborious ... cgi pmidlookup?view long&pmid 7678018 ref DNA sequencing has become easier and orders of magnitude ... pmid 1264203 doi 10.1038 260500a0 ref Prior to the development of rapid DNA sequencing methods in the early ... nobel prizes chemistry laureates 1980 gilbert lecture.pdf DNA sequencing and gene structure . Nobel ... Sanger75 cite journal author Sanger F, Coulson AR title A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase journal J. Mol. Biol. volume 94 issue 3 pages 441 8 year ..., Nicklen S, Coulson AR title DNA sequencing with chain terminating inhibitors journal Proc. Natl. Acad ... a DNA sequencing method based on chemical modification of DNA and subsequent cleavage at specific ... DNA journal Proc. Natl. Acad. Sci. U.S.A. volume 74 issue 2 pages 560 4 year 1977 month February ... 1980 sanger lecture.pdf Determination of nucleotide sequences in DNA . Nobel lecture, 8 December 1980. ref Maxam Gilbert sequencing rapidly became more popular, since purified DNA could be used directly ... stranded DNA. However, with the improvement of the chain termination method see below , Maxam Gilbert ... radioactive labeling at one 5 end of the DNA typically by a kinase reaction using gamma sup 32 sup ... more details
DNA synthesis commonly refers to DNA replication DNA biosynthesis in vivo DNA amplification Polymerase chain reaction enzymatic DNA synthesis in vitro DNA amplification Oligonucleotide synthesis chemical synthesis of nucleic acids Gene synthesis physically creating artificial gene sequences disamb ... more details
wiktionary DNA TOCright DNA is a nucleic acid that contains the genetic instructions specifying the biological development of all cellular life. DNA may also refer to Business DNA Model Management , a modeling agency based in New York City DNA Productions , an American animation studio DNA Studio , an advertising agency DNA Oy , a Finnish telecommunications company Computing BitTorrent DNA , download accelerator Digital Network Architecture DNA , a peer to peer network architecture by Digital Equipement Corporation implemented into the DECnet protocols suite DNA computing , which uses deoxyribonucleic acid and molecular biology instead of a traditional silicon based computer technologies Windows DNA , a defunct predecessor of the Microsoft .NET Framework Music D.N.A. , a song by A Flock of Seagulls on their album A Flock of Seagulls album D.N.A. album D.N.A. album , the fourth studio album by American RnB singer Mario entertainer Mario DNA , a rock band formed in 1983 by Rick Derringer and Carmine Appice DNA band , a New York band DNA dance music band DNA Lounge , a nightclub in San Francisco ... DNA Magazine , an Australian magazine for gay men Les Derni res Nouvelles d Alsace , commonly referred to as Les DNA , French newspaper edited in Strasbourg Other uses DNA Red Dwarf DNA Red Dwarf TV episode DNA , a 15 episode anime series based on the manga by Masakazu Katsura Defense Nuclear Agency , a United States Department of Defense combat support agency DnA, a pen name used jointly by writers ... LA and multi agent systems MAS DNA, a nickname for Douglas Adams , whose middle name was Noel Senyo Amoaku D.N.A. , the pseudonym of American film actor Senyo Amoaku. See also DNA profiling disambig Interwikies de DNA Begriffskl rung es DNA desambiguaci n eo DNA apartigilo fa DNA fr DNA ko DNA it DNA disambigua nl DNA ja DNA no Dna nn DNA fleirtyding pl Dna ro DNA sk DNA fi DNA t smennyssivu sv DNA olika betydelser tr DNA anlam ayr m vi DNA nh h ng zh DNA ... more details
Unreferenced date February 2011 Nuclear DNA , nuclear deoxyribonucleic acid nDNA , is DNA contained within a cell nucleus nucleus of eukaryote eukaryotic organisms . In most cases it encodes more of the genome than the mitochondrial DNA and is passed sexually rather than matrilineally. Nuclear DNA is the most common DNA used in forensic examinations. See also Chromatin Nucleic acids DEFAULTSORT Nuclear Dna Category DNA Cell biology stub ar ca ADN nuclear fr ADN nucl aire pl NDNA pt DNA nuclear ... more details
orphan date September 2010 It is a DNA contained in organelle s, outside the cell nucleus nucleus of eukaryote Eukaryotic cells . Examples mitochondria contain mitochondrial DNA plastid s e.g., chloroplasts contain plastid DNA Structure Unlike nuclear DNA , which is present as linear molecule s inside the chromosome s, organellar DNA is present as circular molecules of high copy number. Also, because organelles are uniparentally inherited in many organisms, so is their organellar DNA. See also Nuclear DNA Category DNA biology stub ar ... more details
unreferenced date July 2008 A DNA Bank is a service like a sperm bank or tissue bank , where DNA is extracted from certain patients tissues at the patient s request with medical advice, then frozen and stored indefinitely, so the DNA is available for future testing. See also Cord blood bank DNA database Category DNA Category DNA sequencing ... more details
Unreferenced date March 2009 About the biotechnological tool the laboratory phenomenon DNA laddering Image DNAgel4wiki.png thumb An agarose gel with a 1 kb ladder, far right A DNA ladder is a solution of DNA molecules of different lengths used in agarose gel electrophoresis . It is applied to an agarose gel as a reference to estimate the size of unknown DNA molecules. In addition it can be used to approximate the mass of a band by comparison to a special mass ladder. Structure Different DNA ladders are commercially available depending on expected DNA length. The 1kb ladder with fragment ranging from about 0.5 kbp to 10 or 12 kbp and the 100 bp ladder with fragments ranging from 100 Base pair bp to just above 1000 bp are the most frequent. DNA ladders are often produced by a suitable restriction digest of a plasmid . There are special DNA ladders for DNA Supercoiled DNA supercoiled DNA and RNA. For example, a DNA HindIII Digest a common lambda DNA ladder that has band sizes in base pair s of 23,130 9,416 6,557 4,361 2,322 2,027 564 and 125 bp Category Biotechnology Category Biological techniques and tools ar de DNA Leiter fr Marqueur de poids mol culaire nl DNA ladder ... more details
Orphan date February 2009 C DNA also known as C form DNA . It is one of the many possible double helical structures of DNA . This form of DNA could be observed at some conditions that relatively low humidity and with certain ions , such as Li sup sup or Mg sup 2 sup . Recent research suggests that both C DNA and B DNA consist of two distinct nucleotide Conformational isomerism conformation s, B I and B II. The ratio of B II conformation in C DNA is more than 40 . However, the ratio of B II conformation in B DNA is only about 10 . See also B DNA A DNA Mechanical properties of DNA References cite journal author L van Dam, M H Levitt title BII nucleotides in the B and C forms of natural sequence polymeric DNA A new model for the C form of DNA journal J Mol Biol volume 304 issue 4 pages 541 61 year 2000 pmid 11099379 doi 10.1006 jmbi.2000.4194 Biochem stub Nucleic acids Category DNA zh C DNA ... more details
Unreferenced date December 2009 Extrachromosomal DNA sometimes called extranuclear DNA or nonchromosomal DNA is DNA located or maintained in a cell biology cell apart from the chromosomes . In many cases, extrachromosomal DNA is contained in cytoplasmic organelles , such as mitochondria most eukaryotes , and in chloroplast s and plastid s plants . Extrachromosomal DNA can also be found in the plasmids of bacteria , or in intracellular parasitism parasites such as virus es. Certain types of cells such as cancer cells and cells maintained in cell culture artificial culture are known to acquire extrachromosomal DNA which provides them a selective advantage for growth under specific conditions. One example being the extrachromosomal double minute s which have been shown to contain oncogenes and provide growth enhancement in certain cancers. Extrachromosomal DNA sometimes contains addiction module s, a system that mediates cell death . DEFAULTSORT Extrachromosomal Dna Category DNA ur ... more details
Encyclopedia
top
