Onesource date June 2009 DNAend or sticky end refers to the properties of the end of a molecule of DNA or a recombinant DNA molecule. The concept is important in molecular biology , especially in Clone genetics cloning or when subcloning inserts DNA into vector DNA. All the terms can also be used in reference ... DNAend of a double stranded molecule is called a blunt end . In a blunt ended molecule both strands terminate in a base pair . Blunt ends are not always desired in biotechnology since when using a DNA ... by various overhangs . An overhang is a stretch of unpaired nucleotide s in the end of a DNA molecule ... stranded or other multi stranded DNA molecule near the end with a significant proportion of non ... ends can anneal, even those from two different organisms. This bondage is temporary however, and DNA ... to join the two molecules together. Single stranded DNA molecules A single stranded non circular DNA molecule has two non identical ends, Directionality molecular biology the 3 end and the 5 end usually pronounced three prime end and five prime end . The numbers refer to the numbering of carbon atoms in the deoxyribose , which is a sugar forming an important part of the backbone of the DNA molecule. In the backbone of DNA the 5 carbon of one deoxyribose is linked to the 3 carbon of another ..., and so forth. Variations in double stranded molecules When a molecule of DNA is double stranded, as DNA usually is, the two strands run in opposite directions. Therefore, one end of the molecule will have the 3 end of strand 1 and the 5 end of strand 2, and vice versa in the other end. However, the fact ... subcloning, it also has the disadvantage of potentially inserting the insert DNA in the opposite ... is an example of a small piece of blunt ended DNA 5 font color red CTGATCTGACTGATGCGTATGCTAGT font ... often adenosine and is created as a 3 overhang by some DNA polymerase s. Most commonly this is used in cloning PCR products created by such an enzyme. The product is joined with a linear DNA ... more details
S0092 8674 00 80760 6 ref At the very end of the T loop, the single stranded telomere DNA is held ... DNA Further Branched DNA and DNA nanotechnology In DNADNAend Frayed ends fraying occurs when non complementary regions exist at the end of an otherwise complementary double strand of DNA. However ...File DNA Structure Key Labelled.png thumb right 340px The structure of the DNA double helix . The atoms ... ADN animation.gif thumb The structure of part of a DNA double helix Deoxyribonucleic acid IPA en di ksi ra b .nju kle . k s d en us Deoxyribonucleic acid.ogg , or DNA , is a nucleic acid that contains ... organism s with the exception of RNA virus es . The main role of DNA molecule s is the long term storage of information . DNA is often compared to a set of blueprint s, like a recipe or a code, since ... s and RNA molecules. The DNA segments that carry this genetic information are called gene s, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. DNA consists of two long polymers of simple units called nucleotide s, with backbone ... is read by copying stretches of DNA into the related nucleic acid RNA, in a process called transcription genetics transcription . Within cells, DNA is organized into long structures called chromosome s. These chromosomes are duplicated before cells cell division divide , in a process called DNA ... most of their DNA inside the cell nucleus and some of their DNA in organelle s, such as mitochondria ... store their DNA only in the cytoplasm . Within the chromosomes, chromatin proteins such as histone s compact and organize DNA. These compact structures guide the interactions between DNA and other proteins, helping control which parts of the DNA are transcribed. Properties File DNA chemical structure.svg thumb 300px Chemical structure of DNA. Hydrogen bond s shown as dotted lines. DNA is a long polymer ... 57023651 69932405 ref ref name Butler cite book author Butler, John M. year 2001 title Forensic DNA ... more details
Image A DNA orbit animated small.gif right frame The A DNA structure. A DNA is one of the many possible double helical structures of DNA . A DNA is thought to be one of three biologically active double helical structures along with B DNA B and Z DNA . It is a right handed double helix fairly similar to the more common and well known B DNA form, but with a shorter more compact helical structure. It appears likely that it occurs only in dehydrated samples of DNA, such as those used in crystallographic experiments, and possibly is also assumed by DNA RNA hybrid helices and by regions of double stranded RNA. Structure A DNA is fairly similar to B DNA given that it is a right handed double helix with major ... turn. This results in a deepening of the major groove and a shallowing of the minor. Predicting A DNA structure An algorithm for predicting the propensity of a sequence to flip from B DNA to A DNA ... cite journal author Basham B, Schroth GP, Ho PS title An A DNA triplet code thermodynamic rules for predicting A and B DNA journal Proc Natl Acad Sci USA volume 92 issue 14 pages 6464 6468 year ... in the hydration of DNA surfaces can be used to distinguish between sequences that form A and B DNA. From this, a triplet code of A DNA propensities was derived as energetic rules for predicting A DNA formation. This code correctly predicted 90 of A and B DNA sequences in crystals and correlates with A DNA formation in solution. Thus, with our previous studies on Z DNA, we now have a single method to predict the relative stability of sequences in the three standard DNA duplex conformations. ref name Basham1995 cite journal author Basham B, Schroth GP, Ho PS title An A DNA triplet code thermodynamic rules for predicting A and B DNA journal Proc Natl Acad Sci USA volume 92 issue 14 pages ... of the Most Common DNA Forms Image A DNA, B DNA and Z DNA.png right thumb Side view of A , B , and Z DNA. Image B&Z&A DNA formula.jpg thumb right 250px The helix axis of A , B , and Z DNA. class ... more details
Infobox animanga Header name DNA image caption ja kanji D N A ja romaji D En Ei Ts Dokoka de Nakushita Aitsu no Aitsu genre Harem genre Harem , Science fiction Infobox animanga Print type manga author Masakazu Katsura publisher Shueisha publisher other flagicon FRA Editions Tonkam br flagicon GER Carlsen Comics br flagicon MEX Grupo Editorial Vid br flagicon ESP Planeta DeAgostini Comics br flagicon BRA Editora JBC demographic Sh nen manga Sh nen magazine Weekly Sh nen Jump first 1993 last 1994 volumes 5 volume list Infobox animanga Video type tv series director Jun ichi Sakata producer writer music studio Madhouse company Madhouse br Studio Deen network Animax , Nippon Television network other flagicon KOR Animax first 7 October 1994 last 23 December 1994 episodes 12 episode list Infobox animanga Video type ova director Jun ichi Sakata producer writer music studio Madhouse company Madhouse br Studio Deen released 1995 runtime episodes 3 episode list Infobox animanga Footer nihongo DNA D N A D En Ei Ts Dokoka de Nakushita Aitsu no Aitsu is a science ... 100 children that carry the Mega Playboy DNA, causing them and all their descendants to each have 100 ... to deal with. Karin reveals to Junta that she is a DNA Operator . Her job is to make alterations in people s DNA that will change their nature for the greater good of society. She intends to shoot the original Mega Playboy with a DCM DNA Control Medicine bullet that will alter his DNA in order ... DCM bullet. However, each time he transforms, his Mega Playboy DNA stabilizes more and more. nihongo Karin Aoi Aoi Karin anime voices Miina Tominaga Jessica Calvello A sixteen year old DNA ... Never Forget You Manga The DNA manga was published in Japanese magazine Weekly Sh nen Jump 1993 No. 36 ... es ca DNA cs DNA de DNA es DNA fr DNA ko DNA id DNA it DNA ja D N A pt DNA ru DNA fi DNA sv DNA tl DNA zh DNA ... more details
a ligase works with DNAend sticky end s Image Ligation.svg 400px Ligase will also work with DNAend ... with XRCC4 . It catalyzes the final step in the non homologous end joining DNA double strand break repair ... DNAend Lagging strand DNA replication Okazaki fragment DNA Polymerase References cite web url http ...Refimprove date February 2007 enzyme Name DNA ligase EC number 6.5.1.1 CAS number 9015 85 4 IUBMB EC number 6 5 1 1 GO code 0003910 image DNA Ligase.jpg width caption DNA ligase I protein Name ligase I, DNA, ATP dependent caption image width 200 HGNCid 6598 Symbol LIG1 AltSymbols EntrezGene 3978 OMIM ... Name ligase III, DNA, ATP dependent caption image width HGNCid 6600 Symbol LIG3 AltSymbols EntrezGene ... LocusSupplementaryData q12 protein Name ligase IV, DNA, ATP dependent caption image width HGNCid 6601 ... 13 Arm q Band 33 LocusSupplementaryData q34 In molecular biology , DNA ligase is a special ... in double stranded DNA molecules, in simple words strands that have double strand break a break in both complementary strands of DNA . Purified DNA ligase is used in gene cloning to join DNA ... type of DNA ligase using the Complementary DNA complementary strand as a template Citation needed date April 2010 but still requires DNA ligase to create the final phosphodiester bond to fully repair the DNA. DNA ligase has applications in both DNA repair and DNA replication see DNA ligase Mammalian ligases Mammalian ligases . In addition, DNA ligase has extensive use in molecular biology laboratories for Genetic recombination experiments see DNA ligase Applications in molecular biology research Applications in molecular biology research . Ligase mechanism The mechanism of DNA ligase is to form two covalent phosphodiester bonds between 3 end 3 hydroxyl ends of one nucleotide , acceptor with the 5 end 5 phosphate end of another donor . ATP is required for the ligase reaction, which proceeds ... and the 3 hydroxyl of the acceptor. ref name pmid4377758 cite journal author Lehman IR title DNA ligase ... more details
Image DNA polymerase.png thumb 3D structure of the DNA binding helix turn helix motifs in human DNA polymerase beta A DNA polymerase is an enzyme that catalyze s the polymerization of deoxyribonucleotide s into a DNA strand. DNA polymerases are best known for their Negative feedback feedback role in DNA replication , in which the polymerase reads an intact DNA strand as a wikt template template and uses it to synthesize the new strand. This process copies a piece of DNA. The newly polymerized molecule .... DNA polymerases use magnesium ions as Cofactor biochemistry cofactors . Human DNA polymerases are 900 1000 amino acids long. Function Image DNA polymerase.svg thumb 200px right DNA polymerase with proofreading ability DNA polymerase can add free nucleotides to only the 3 end of the newly forming strand. This results in elongation of the new strand in a 5 3 direction. No known DNA polymerase is able to begin a new chain de novo . DNA polymerase can add a nucleotide onto only a preexisting 3 hydroxide ... nucleotide. Primers consist of RNA and or DNA bases. In DNA replication, the first two bases are always ... to unwind DNA from a double strand structure to a single strand structure to facilitate replication of each strand consistent with the semiconservative model of DNA replication. Error correction is a property of some, but not all, DNA polymerases. This process corrects mistakes in newly synthesized DNA. When an incorrect base pair is recognized, DNA polymerase reverses its direction by one base pair of DNA. The 3 5 exonuclease activity of the enzyme allows the incorrect base pair to be excised ... can re insert the correct base and replication can continue. Various DNA polymerases are extensively used in molecular biology experiments. Variation across species DNA polymerases have highly ... special DNA polymerases, such as Hepatitis B virus DNA polymerase . These may selectively replicate viral DNA through a variety of mechanisms. Retroviruses encode an unusual DNA polymerase called reverse ... more details
A DNA machine is a molecular machine constructed from DNA . Research into DNA machines was pioneered in the late 1980s by Nadrian Seeman and co workers from New York University . DNA is used because of the numerous biological tools already found in nature that can affect DNA, and the immense knowledge of how DNA works previously researched by biochemistry biochemists . DNA machines can be logically designed since DNA assembly of the double helix is based on strict rules of base pairing that allow portions of the strand to be predictably connected based on their sequence. This selective stickiness is a key advantage in the construction of DNA machines. An example of a DNA machine was reported by Bernard Yurke and co workers at Lucent Technologies in the year 2000, who constructed molecular tweezers out of DNA. ref name pmid10949296 cite journal author Yurke B, Turberfield AJ, Mills AP, Simmel FC, Neumann JL title A DNA fuelled molecular machine made of DNA journal Nature volume 406 issue 6796 pages 605 8 year 2000 month August pmid 10949296 doi 10.1038 35020524 url ref The DNA tweezers contain three strands A, B and C. Strand A latches onto half of strand B and half of strand C, and so it joins them all together. Strand A acts as a hinge so that the two arms &mdash AB and AC &mdash can move. The structure floats with its arms open wide. They can be pulled shut by adding a fourth strand of DNA D programmed to stick to both of the dangling, unpaired sections of strands B and C. The closing of the tweezers was proven by tagging strand A at either end with light emitting molecules ... BAC, so float away. The DNA machine can be opened and closed repeatedly by cycling between strands ... a self assembled DNA tetrahedron . The state of the device can be determined by measuring the separation ... reflist See also DNA nanotechnology Category DNA nanotechnology Category Molecular machines sci stub ar it Macchina di DNA ru ... more details
Image DNA Agarose Gel Electrophor.jpg 200px thumb right Digital printout of an agarose gel electrophoresis of cat insert plasmid DNA Image Electropherogram trace.jpg thumb 200px DNA electropherogram trace DNA electrophoresis is an analytical technique used to separate DNA fragments by size. DNA molecules ... the DNA to migrate toward the anode , due to the net negative charge of the sugar phosphate backbone of the DNA chain. The separation of these fragments is accomplished by exploiting the mobilities ... its mobility, smaller fragments end up nearer to the anode than longer ones in a given period ... across a low voltage gel yield the most accurate resolution. The DNA to be separated can be prepared in several ways before separation by electrophoresis. In the case of large DNA molecules, the DNA is frequently cut into smaller fragments using a DNA restriction endonuclease or called restriction ... affect the separation of the molecules are removed through various means before analysis. Once the DNA is properly prepared, the samples of the DNA solution are placed in the wells of the gel and a voltage is applied across the gel for a specified amount of time. The DNA fragments of different lengths are visualized using a fluorescent dye specific for DNA, such as ethidium bromide . The gel shows bands corresponding to different DNA molecules populations with different molecular weight. Fragment ... upon whether single or double stranded DNA has been separated. Fragment size determination is typically done by comparison to commercially available molecular weight size marker DNA markers containing linear DNA fragments of known length. The types of gel most commonly used for DNA electrophoresis are agarose gel electrophoresis agarose for relatively long DNA molecules and polyacrylamide gel electrophoresis polyacrylamide for high resolution of short DNA molecules, for example in DNA sequencing ... electrophoresis has become important for applications such as high throughput DNA sequencing. Electrophoresis ... more details
Image Ti Plasmid.jpg thumb 350px right Ti plasmid with T DNA region The transfer DNA abbreviated T DNA is the transferred deoxyribonucleic acid DNA of the Ti plasmid tumor inducing Ti plasmid of some species of bacteria such as Agrobacterium tumefaciens and Agrobacterium rhizogenes . It derives its name from the fact that the bacterium transfers this DNA fragment into the host plant s cell nucleus nuclear DNA genome . The T DNA is bordered by 25 base pair repeats on each end. Transfer is initiated at the left border and terminated at the right border and requires the vir genes of the Ti plasmid. The bacterial T DNA is about 20,000 base pairs long and contains gene s that code for enzyme s synthesizing opines and phytohormone s. By transferring the T DNA into the plant genome, the bacterium essentially reprograms the plant cells to grow into a tumor and produce a unique food source for the bacteria. The synthesis of the plant hormones auxin and cytokinin enables the plant cell to grow uncontrollably, thus forming the crown gall tumor s typically induced by Agrobacterium infection. The opines are amino acid derivatives used by the bacterium as a source of carbon and energy. T DNA transformation Agrobacterium mediated T DNA transfer is widely used as a tool in biotechnology . In genetic engineering , the tumor promoting and opine synthesis genes are removed from the T DNA and replaced with a gene of interest and or a selection marker, this is required so that it is possible to establish ... of glutamine synthetase . Agrobacterium is then used as a vector to transfer the engineered T DNA ... transgenic plant s carrying a foreign gene. T DNA mutagenesis The same procedure of T DNA transfer can be used to disrupt genes via insertional mutagenesis . Not only does the inserted T DNA sequence ... Publishers, New York, ISBN 0 7167 1007 2 DEFAULTSORT T Dna Category Biotechnology Category ... fr ADN T pl T DNA sv T DNA ... more details
DNA condensation refers to the process of compacting DNA molecules in vitro or in vivo . ref name Teif cite journal author Teif V.B. and Bohinc K. year 2010 title Condensed DNA condensing the concepts ... details of DNA packing are essential for its functioning in the process of gene regulation in living systems. Condensed DNA often has surprising properties, which one would not predict from classical concepts of dilute solutions. Therefore DNA condensation in vitro serves as a Scientific model ... journal author Bloomfield V.A. year 1996 pages 334 title DNA condensation volume 6 journal Current Opinion in Structural Biology doi 10.1016 S0959 440X 96 80052 2 ref In addition, DNA condensation has many potential applications in medicine and biotechnology . ref name Teif DNA diameter is about 2 ... depending on the organism. Many features of the DNA double helix contribute to its large stiffness, including ... phosphate s DNA bears on average one elementary negative charge per each 0.17 nm of the double .... DNA is one of the stiffest natural polymers, yet it is also one of the longest molecules. This means that at large distances DNA can be considered as a flexible rope, and on a short scale as a stiff rod. Like a garden hose, unpacked DNA would randomly occupy a much larger volume than when it is orderly packed. Mathematically, for a non interacting flexible chain randomly diffusing in 3D, the end to end distance would scale as a square root of the polymer length. For real polymers such as DNA this gives only very rough estimate what is important, is that the space available for the DNA .... In order to cope with the volume constraints, DNA has a striking property to pack itself in the appropriate solution conditions with the help of ions and other molecules. Usually, DNA condensation is defined as the collapse of extended DNA chains into compact, orderly particles containing only ... 269 title DNA condensation by multivalent cations volume 44 journal Biopolymers doi 10.1002 SICI ... more details
site. Labeling The DNA template can be labeled at the 3 or 5 end, depending on the location of the binding site s . Labels that can be used are Radioactivity has been traditionally used to label DNA ...DNA footprinting is a method of investigating the sequence specificity of DNA binding proteins in vitro. This technique can be used to study protein DNA interactions both outside and within cells. The regulation ... promoters , enhancers , or Silencer DNA silencers to drive or repress transcription are fundamental to understanding the unique regulation of individual genes within the genome . Techniques like DNA footprinting will help elucidate which proteins bind to these regions of DNA and unravel the complexities of transcriptional control. Method Image Courtney 2008.jpg thumb 400px Figure 1. DNA footprinting ... of interest within a DNA molecule. The wet lab methodology is summarized, with appropriate ... of DNA binding ligands. Methods. 42 128 140. ref Polymerase chain reaction PCR amplify and label ... base pairs in length. Add protein of interest to a portion of the labeled template DNA a portion ... of DNA template. The cleavage agent is a chemical or enzyme that will cut at random locations in a sequence independent manner. The reaction should occur just long enough to cut each DNA molecule in only one location. A protein that specifically binds a region within the DNA template will protect the DNA it is bound to from the cleavage agent. Run both samples side by side on a polyacrylamide gel electrophoresis . The portion of DNA template without protein will be cut at random locations, and thus when it is run on a gel, will produce a ladder like distribution. The DNA template with the protein will result in ladder distribution with a break in it, the footprint , where the DNA has been protected from the cleavage agent. Note Maxam Gilbert chemical DNA sequencing can be run alongside the samples ... small amounts of DNA. Fluorescence is a desirable advancement due to the hazards of using radio chemicals ... more details
DNADNA hybridization generally refers to a molecular biology technique that measures the degree of genetic similarity between pools of DNA sequences. It is usually used to determine the genetic distance between two species . When several species are compared that way, the similarity values allow the species to be arranged in a phylogenetic tree it is therefore one possible approach to carrying out molecular systematics . Charles Sibley and Jon Ahlquist , pioneers of the technique, used DNADNA hybridization to examine the phylogenetic relationships of avians the Sibley Ahlquist taxonomy and primates. ref http evolution.berkeley.edu evolibrary article 0 history 26 Genetic Similarities Wilson, Sarich, Sibley, and Ahlquist ref ref cite journal title The Phylogeny of the Hominoid Primates, as Indicated by DNADNA Hybridization author C.G. Sibley and J.E. Ahlquist journal Journal of Molecular ... DNA hybridization in the apes Technical issues ref DNA sequencing and computational comparisons ... DNADNA hybridization to study complex microbial ecosystems author S.S. Socransky, A.D. Haffajee ... The DNA of one organism is labeled, then mixed with the unlabeled DNA to be compared against. The mixture is incubated to allow DNA strands to dissociate and reanneal, forming hybrid double stranded DNA ..., a process known as DNA melting . To assess the melting profile of the hybridized DNA, the double stranded DNA is bound to a column and the mixture is heated in small steps. At each step, the column ... labeled DNA comes off the column reflects the amount of similarity between sequences and the self ... . Fundamentals of Molecular Evolution. a good text on these topics See also DNA melting Temperature gradient gel electrophoresis Category Molecular biology Category DNA fr Hybridation de l ADN hu DNS DNS hibridiz ci nl DNADNA hybridisatie ja DNADNA pt Hibridiza o de DNADNA sv DNADNA hybridisering tr DNADNA hibridizasyon ... more details
to the 3 end of a DNA strand. The pairing of bases in DNA through hydrogen bonding means that the information ... to the 5 end of a strand of DNA. ref Allison, Lizabeth A. Fundamental Molecular Biology . Blackwell ... a new strand of DNA by extending the 3 end of an existing nucleotide chain, adding new nucleotide ... the 5 end of the growing strand rather than from free nucleotides. In general, DNA polymerases are extremely ... face of the clamp enables DNA to be threaded through it. Once the polymerase reaches the end of the template ... the very end of the chromosomes, but ends at the telomere region of repetitive DNA close to the end ...Merge from Replication fork discuss Talk DNA replication Merge from Replication fork date May 2009 Image DNA replication split.svg thumb 200px right DNA replication. The double helix is unwound and each strand acts as a template. Nucleotides Bases are matched to synthesize the new partner strands. DNA replication is a biological process that occurs in all life on Earth living organisms and copies their DNA ... DNA molecule and produces two identical copies of the molecule. Each strand of the original double stranded DNA molecule serves as template for the production of the complementary strand. Cellular ... fidelity for DNA replication. ref cite book author Berg JM, Tymoczko JL, Stryer L, Clarke ND title ... books bv.fc,kgi?rid stryer.chapter.3740 Chapter 27 DNA Replication, Recombination, and Repair ref ... bv.fcgi?rid mboc4.chapter.747 Chapter 5 DNA Replication, Repair, and Recombination ref In a cell biology cell , DNA replication begins at specific locations in the genome, called origin of replication ... bofghoks bv.fcvbngi?rid stryer.section.3794 Chapter 27, Section 4 DNA Replication of Both Strands Proceeds Rapidly from Specific Start Sites ref Unwinding of DNA at the origin, and synthesis of new strands, forms a replication fork . In addition to DNA polymerase , the enzyme that synthesizes the new DNA by adding nucleotides matched to the template strand, a number of other protein s are associated ... more details
Ask DNA could be Ask DNA album Ask DNA album , the soundtrack to Cowboy Bebop The Movie Ask DNA song Ask DNA song , the theme song to the aforementioned film disambig ... more details
DNA fragmentation is the separation or breaking of DNA strands into pieces. It can be intentional by laboratory personnel or the cells, or it can be spontaneous. Intentional Restriction digest is the intentional laboratory breaking of DNA strands. Apoptosis DNA fragmentation is a natural fragmentation that cells perform in apoptosis programmed cell death Spontaneous Spontaneous or accidental DNA fragmentation is fragmentation that gradually accumulates in a cell. It can be measured by e.g. Comet assay . The degree of DNA fragmentation can predict outcomes for in vitro fertilization ref cite journal author Simon L, Brunborg G, Stevenson M, Lutton D, McManus J, Lewis SE title Clinical significance of sperm DNA damage in assisted reproduction outcome journal Hum Reprod volume issue pages year 2010 month May pmid 20447937 doi 10.1093 humrep deq103 url ref IVF and its expansion intracytoplasmic sperm injection ref name speyer ICSI . The sperm chromatin dispersion test SCD and TUNEL assay are both effective in detecting sperm DNA damage. ref name Zhang cite journal author Zhang LH, Qiu Y, Wang KH, Wang Q, Tao G, Wang LG title Measurement of sperm DNA fragmentation using bright field microscopy comparison between sperm chromatin dispersion test and terminal uridine nick end labeling assay journal Fertil. Steril. volume issue pages year 2009 month June pmid 19505686 doi 10.1016 j.fertnstert.2009.04.034 url ref Using bright field microscopy , the SCD test appears to be more sensitive than the TUNEL assay. ref name Zhang Its main units of measurement is DNA fragmentation index DFI . ref name speyer cite journal author Speyer BE, Pizzey AR, Ranieri M, Joshi R, Delhanty JD, Serhal P title Fall in implantation rates following ICSI with sperm with high DNA fragmentation journal Hum Reprod volume issue pages year 2010 month May pmid 20495207 doi 10.1093 humrep deq116 url ref A DFI of 20 ... DNA medicine stub ... more details
Wiktionary The End may refer to TOC right Literature The End novel The End novel , the last volume of A Series of Unfortunate Events by Lemony Snicket The End comics The End comics , a series published by Marvel Comics The End story The End story , a short story by Jorge Luis Borges in his book Ficciones Music Songs The End The Beatles song The End The Beatles song The End The Doors song The End The Doors song The End Earl Grant song The End Earl Grant song The End Groove Coverage song The End Groove Coverage song The End Roadrunner United song The End Roadrunner United song The End , by Andrew F from Reckless Abandon album Reckless Abandon The End , by Behemoth from Thelema.6 The End , by Bullet for My Valentine from The Poison The End , by The Classic Crime from The Silver Cord The End , by Cryptopsy from Once Was Not The End , by Derek Webb from The Ringing Bell The End , by Discharge from Hear Nothing See Nothing Say Nothing The End , by Dream Evil from Evilized The End , by Ellie Goulding from Lights Ellie Goulding album Bright Lights The End , by Laleh from Me and Simon The End , by Mayday Parade from Anywhere but Here Mayday Parade album Anywhere but Here The End , by McFly from Radio Active The End , by Mr. Oizo from Moustache Half a Scissor The End. , by My Chemical Romance from The Black Parade The End , by Pearl Jam from Backspacer The End , by Ryan Adams from Jacksonville City Nights The End , by Silverstein from A Shipwreck in the Sand The End , by Simple Plan from Simple Plan album Simple Plan Albums The End Crack the Sky album The End Crack the Sky album The End Mika Nakashima album The End Mika Nakashima album The End Nico album The End Nico album The E.N.D. , an album by Black Eyed Peas Chapter 1 The End , by Three 6 Mafia The End Forever in Terror album The End Forever in Terror album , by Forever in Terror The End , by Spectre musician Spectre The End , by Whiskers band Whiskers Performers The End UK band , a 1960s British psychedelic pop band The End ... more details
with the presence of foreign DNA via the route of sticky end ligation, or with blunt ends via blunt ...Recombinant DNA rDNA is a form of artificial DNA that is created by combining two or more Nucleic acid ... oclc ref In terms of genetic modification , it is created through the introduction of relevant DNA into an existing organismal DNA, such as the plasmid s of bacteria , to code for or alter different traits ... isbn0 7167 8724 5 A recombinant protein is a protein that is produced from recombinant DNA. ref ... DNA in classical biology, as the term clone refers to a cell or organism derived from a parental ..., the use of recombinant DNA provides the initial cell from which the host organism is then expected ... due to the use of viral vector s in medicine that contain recombinant DNA inserted into a structure ... forms of DNA present in most bacteria, such as Escherichia coli E. Coli , containing genes related ... the attachment of a selected segment of DNA, which codes for more reparative substances, such as peptide ... to reproduce so as to recapitulate the altered DNA within other cells it infects, and increase the amount of cells with the recombinant DNA present within them. The use of plasmids is also key within ... of transporting and passing on genes in recombinant DNA through viral reproduction throughout an organism ... to allow identification of successfully recombined DNA. ref name isbn0 7167 8724 5 The cloning ... foreign DNA into the genomes of many plants. Other methods of introducing or creating recombinant DNA in eukaryotes include homologous recombination and transfection with modified viruses . Chimeric ... blunt ends via the enzyme, T4 Ligase. When recombinant DNA is then further altered or changed to host additional strands of DNA, the molecule formed is referred to as chimeric DNA molecule, ref name ... and bacterial cells that all contain copies of the original chimeric DNA. ref name isbn0 7167 8724 ..., ref name isbn0 7167 8724 5 as the intended outcome of the addition of foreign DNA may not always ... more details
wiktionary endEnd or Ending may refer to End philosophy In mathematics End category theory End topology End American football End, a division of play in the sports of curling and target archery End key on a modern computer keyboard End Records , a record label End , a song by The Cure from Wish The Cure album Wish End , a Song from Silent Night Fever by Dimension Zero End, in weaving, a single thread of the warp weaving warp END may refer to European Nuclear Disarmament Endoglin , a glycoprotein Equivalent narcotic depth , a concept used in underwater diving Ending may refer to Ending linguistics Alternate ending End of a part of a baseball game False ending Happy ending Multiple endings Twist ending See also lookfrom intitle The End disambiguation End of the world disambiguation Front end disambiguation Boundary disambiguation Telos philosophy , a goal or final state Conclude disambiguation Terminate disambiguation disambig de Ende el es Fin fr FIN it End ja ... more details
To the End may refer to To the End Blur song , a song by the rock band Blur. To the End My Chemical Romance song , a song by the rock band My Chemical Romance. disambig ... more details
DNA synthesis commonly refers to DNA replication DNA biosynthesis in vivo DNA amplification Polymerase chain reaction enzymatic DNA synthesis in vitro DNA amplification Oligonucleotide synthesis chemical synthesis of nucleic acids Gene synthesis physically creating artificial gene sequences disamb ... more details
interest in using DNA nanotechnology to assemble molecular electronics devices. To this end, DNA has ...Image DNA tetrahedron white.png thumb right 275px DNA nanotechnology seeks to make artificial, Nucleic acid design designed nanostructures out of nucleic acids , such as this DNA tetrahedron described in Goodman, 2005. ref name Goodman05 Each edge of the tetrahedron is a 20 base pair DNA Nucleic acid double helix double helix , and each vertex is a three arm junction. DNA nanotechnology is a branch of nanotechnology which uses the molecular recognition properties of DNA and other nucleic acid s to create designed, artificial structures out of DNA for technological purposes. In this field, DNA is used ... of bionanotechnology . DNA nanotechnology has applications in molecular self assembly and in DNA computing . Although DNA is usually considered in the context of molecular biology as the carrier of Genetics genetic information in living Cell biology cells , DNA nanotechnology considers DNA solely as a chemical and as a material, and is usually pursued outside of any biological context. DNA nanotechnology ... to each other to form Nucleic acid double helix duplex DNA. DNA nanotechnology attempts to Nucleic acid design rationally design sets of DNA strands so that desired portions of each strand will assemble ... DNA nanotechnology, its principles apply equally well to other nucleic acids such as RNA and Peptide ... schematic.png thumb 250px These four strands associate into a DNA four arm junction because ... 2.jpg thumb 250px A double crossover DX molecule. This molecule consists of five DNA single strands ... of Complexity Lessons from DNA journal PLoS Biology volume 2 issue 12 pages 2036 2038 issn 1544 9173 pmid 15597116 pmc 535573 doi 10.1371 journal.pbio.0020431 ref DNA nanotechnology creates ... of nucleotide s, distinguished by which nucleobase they contain. In DNA, the four bases used are adenine ... of DNA nanotechnology in that sequences are Nucleic acid design rationally designed so that a desired ... more details
strand of DNA which has a loop at an end, are a dynamic structure that opens and closes when a piece ... of toehold exchange. In this system, an input DNA strand binds to a sticky end , or toehold, on another ...DNA computing is a form of computing which uses DNA , biochemistry and molecular biology , instead of the traditional silicon based computer technology technologies . DNA computing, or, more generally ... concerns theory, experiments and applications of DNA computing. History This field was initially ... The first DNA computing paper. Describes a solution for the directed Hamiltonian path problem . ref Adleman demonstrated a proof of concept use of DNA as a form of computation which solved the seven ... of DNA journal DAMATH Discrete Applied Mathematics and Combinatorial Operations Research and Computer ... Gloor, Sheng Yu year 2000 month January title Using DNA to solve the Bounded Post Correspondence ... and DNA molecules instead of silicon microchips. ref cite web url http news.nationalgeographic.com news 2003 02 0224 030224 DNAcomputer.html title Computer Made from DNA and Enzymes accessdate 2009 11 ... in the journal Nature journal Nature that they had constructed a DNA computer coupled with an input ... doi 10.1038 nature02551 ref Capabilities DNA computing is fundamentally similar to parallel computing in that it takes advantage of the many different molecules of DNA to try many different possibilities at once. ref cite journal author David I. Lewin date 2002 title DNA Computing journal Computing in Science & Engineering volume 4 issue 3 pages 5 8 doi 10.1109 5992.998634 ref DNA computing also offers much lower power consumption than traditional silicon computers. DNA uses adenosine ... ref Both strand hybridization and the hydrolysis of the DNA backbone can occur spontaneously, powered by the potential energy stored in DNA. Consumption of two ATP molecules releases 1.5 x 10 sup 19 ... For certain specialized problems, DNA computers are faster and smaller than any other computer built ... more details
MR title Yeast DNA ligase IV mediates non homologous DNAend joining. journal Nature volume 388 ... yeast nonhomologous end joining. Evidence for a DNA polymerase beta Pol4 dependent pathway. journal ...pp move indef for the journal DNA Repair journal Image brokechromo.jpg frame right DNA damage resulting in multiple broken chromosomes DNA repair refers to a collection of processes by which a cell biology cell identifies and corrects damage to the DNA molecules that encode its genome . In human cells ... can cause DNA damage, resulting in as many as 1 million individual molecular lesion s per cell per ... cause structural damage to the DNA molecule and can alter or eliminate the cell s ability to Transcription genetics transcribe the gene that the affected DNA encodes. Other lesions induce ... after it undergoes mitosis . As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. When normal repair processes fail, and when cellular apoptosis does not occur, irreparable DNA damage may occur, including double strand breaks and DNA crosslinkages ... The rate of DNA repair is dependent on many factors, including the cell type, the age of the cell, and the extracellular environment. A cell that has accumulated a large amount of DNA damage, or one that no longer effectively repairs damage incurred to its DNA, can enter one of three possible states ... ous The DNA repair ability of a cell is vital to the integrity of its genome and thus to its normal ... life span have turned out to be involved in DNA damage repair and protection. ref name browner ... of evolution . DNA damage DNA damage, due to environmental factors and normal metabolism metabolic ... formation. The vast majority of DNA damage affects the primary structure of the double helix that is, the bases ... in the standard double helix. Unlike protein s and RNA , DNA usually lacks tertiary structure and therefore damage or disturbance does not occur at that level. DNA is, however, supercoil ed and wound ... more details
New unreviewed article source ArticleWizard date August 2010 Infobox single Name At The End Cover At The End.jpg Artist iiO from Album Poetica Released October 22, 2002 Format Maxi Single , music download digital download Recorded Genre Dance music Dance br Electronic music Electronic Length 3 11 Label Made Records Writer M. Moser, Nadia Ali ref name credit http www.discogs.com iiO At The End release 2247504 Credits discogs.com ref Producer M. Moser Last single Rapture iiO song Rapture br 2001 This single At the End br 2002 Next single Smooth iiO song Smooth br 2003 At The End is the 2nd single by New York house band iiO . It was released on October 22, 2002. Official Remixes At The End Midnite Radio Edit At The End Midnite UK Radio Edit At The End Midnite Extended Mix At The End Midnite Alternative Extended Mix At The End JCA Radio Edit At The End JCA Remix At The End Michael Woods Radio Edit At The End Michael Woods Remix At The End The Scumfrog Remix At The End MadeEdit At The End Johnny Vicious Radio Edit At The End Johnny Vicious Remix At The End Johnny Vicious Dub At The End Frank Bailey 2005 Remix At The End Saeed & Palash Remix At The End UltraSun Remix At The End Sat & Lee Howler Reprise At The End Sat & Lee Howler Remix At The End Fairlite Remix At The End FEOS Treatment At The End Metropolitan Mix Infobox single Name At The End Metropolitan Mix Cover At The End Metropolitan Mix .jpg Artist iiO Album Released December 28, 2010 Format Music download digital download Recorded ... ref name credit http www.discogs.com iiO At The End release 2247504 Writer Credits discogs.com ref Producer ... At The End br 2010 Next single tracklist title1 At The End Radio Edit length1 4 06 title2 At The End Mixshow Edit length2 6 06 title3 At The End Club Mix length3 6 08 title4 At The End Metro ... watch?v 9 MgTXY HCk Official Music Video at Youtube http www.discogs.com iiO At The End master 59327 At The End at Discogs iiO Category 2002 singles Category Nadia Ali ... more details
wiktionary DNA TOCright DNA is a nucleic acid that contains the genetic instructions specifying the biological development of all cellular life. DNA may also refer to Business DNA Model Management , a modeling agency based in New York City DNA Productions , an American animation studio DNA Studio , an advertising agency DNA Oy , a Finnish telecommunications company Computing BitTorrent DNA , download accelerator Digital Network Architecture DNA , a peer to peer network architecture by Digital Equipement Corporation implemented into the DECnet protocols suite DNA computing , which uses deoxyribonucleic acid and molecular biology instead of a traditional silicon based computer technologies Windows DNA , a defunct predecessor of the Microsoft .NET Framework Music D.N.A. , a song by A Flock of Seagulls on their album A Flock of Seagulls album D.N.A. album D.N.A. album , the fourth studio album by American RnB singer Mario entertainer Mario DNA , a rock band formed in 1983 by Rick Derringer and Carmine Appice DNA band , a New York band DNA dance music band DNA Lounge , a nightclub in San Francisco ... DNA Magazine , an Australian magazine for gay men Les Derni res Nouvelles d Alsace , commonly referred to as Les DNA , French newspaper edited in Strasbourg Other uses DNA Red Dwarf DNA Red Dwarf TV episode DNA , a 15 episode anime series based on the manga by Masakazu Katsura Defense Nuclear Agency , a United States Department of Defense combat support agency DnA, a pen name used jointly by writers ... LA and multi agent systems MAS DNA, a nickname for Douglas Adams , whose middle name was Noel Senyo Amoaku D.N.A. , the pseudonym of American film actor Senyo Amoaku. See also DNA profiling disambig Interwikies de DNA Begriffskl rung es DNA desambiguaci n eo DNA apartigilo fa DNA fr DNA ko DNA it DNA disambigua nl DNA ja DNA no Dna nn DNA fleirtyding pl Dna ro DNA sk DNA fi DNA t smennyssivu sv DNA olika betydelser tr DNA anlam ayr m vi DNA nh h ng zh DNA ... more details
Encyclopedia
top
