Search: in
Cytosine
Cytosine in Encyclopedia Encyclopedia
  Tutorials     Encyclopedia     Videos     Books     Software     DVDs  
       
Encyclopedia results for Cytosine

Cytosine





Encyclopedia results for Cytosine

  1. Cytosine

    chembox Verifiedfields changed verifiedrevid 407466535 ImageFile1 Cytosine chemical structure.png ImageSize1 150px ImageFileL2 Cytosine 3D balls.png ImageSizeL2 120px ImageFileR2 Cytosine 3D vdW.png ImageSizeR2 ... OPTASPLRGRRNAP UHFFFAOYAY MeSHName Cytosine Section2 Chembox Properties Formula C sub 4 sub H ... MainHazards FlashPt Autoignition distinguish cytisine cysteine Cytosine C is one of the four main bases ... 4 and a Ketone keto group at position 2 . The nucleoside of cytosine is cytidine . In Watson Crick base pair ing, it forms three hydrogen bonds with guanine . History Cytosine was discovered by Albrecht ... confirmed in the laboratory in the same year. Cytosine recently found use in quantum computation . The first ... algorithm algorithm on a two qubit NMRQC Nuclear Magnetic Resonance Quantum Computer based on the cytosine ... Cytosine chemical structure.svg thumb left 100px Cytosine with numbered components. Methylation occurs on carbon nr 5. Cytosine can be found as part of DNA, as part of RNA, or as a part of a nucleotide ... to convert adenosine diphosphate ADP to adenosine triphosphate ATP . In DNA and RNA, cytosine is paired ... such as uracil glycosylase, which cleaves a uracil in DNA. Cytosine can also be methylated into 5 methylcytosine ... hydroxymethylcytosine . Active enzymatic deamination of cytosine or 5 methylcytosine by the APOBEC family of cytosine deaminases could have both beneficial and detrimental implications on various cellular ... through cytosine deamination journal Trends in Genetics volume 26 pages 443 448 year 2010 ... 200 749 5 cite journal author Shapiro R title Prebiotic cytosine synthesis a critical analysis ... eu Zitosina fa fr Cytosine gl Citosina hi hr Citozin id Sitosina it Citosina he jv Sitosin lt Citozinas hu Citozin nl Cytosine ja no Cytosin oc Citosina pl Cytozyna pt Citosina ru simple Cytosine sk Cytoz n sl Citozin sr sh Citozin fi Sytosiini sv Cytosin tr Sitozin uk ur Cytosine vi Cytosine zh ...   more details



  1. Cytosine deaminase

    enzyme Name cytosine deaminase EC number 3.5.4.1 CAS number 9025 05 2 IUBMB EC number 3 5 4 1 GO code 0004131 image width caption In enzymology , a cytosine deaminase EC number 3.5.4.1 is an enzyme that catalysis catalyzes the chemical reaction cytosine H sub 2 sub O math rightleftharpoons math uracil NH sub 3 sub Thus, the two substrate biochemistry substrates of this enzyme are cytosine and water H sub 2 sub O , whereas its two product chemistry products are uracil and ammonia NH sub 3 sub . This enzyme belongs to the family of hydrolase s, those acting on carbon nitrogen bonds other than peptide bonds, specifically in cyclic amidines. The systematic name of this enzyme class is cytosine aminohydrolase . This enzyme is also called isocytosine deaminase . This enzyme participates in pyrimidine metabolism . Structural studies As of late 2007, 13 tertiary structure structures have been solved for this class of enzymes, with Protein Data Bank PDB accession codes PDB link 1K6W , PDB link 1K70 , PDB link 1OX7 , PDB link 1P6O , PDB link 1R9X , PDB link 1R9Y , PDB link 1RA0 , PDB link 1RA5 , PDB link 1RAK , PDB link 1RB7 , PDB link 1UAQ , PDB link 1YSB , and PDB link 1YSD . References reflist 1 cite journal author COHEN SS, BARNER HD date 1957 title The conversion of 5 methyldeoxycytidine to thymidine in vitro and in vivo journal J. Biol. Chem. volume 226 pages 631&ndash 42 pmid 13438848 issue 2 cite journal author Kream J and Chargaff E date 1952 title On the cytosine deaminase of yeast journal J. Am. Chem. Soc. volume 74 issue 20 pages 5157&ndash 5160 doi 10.1021 ja01140a050 hydrolase stub Category EC 3.5.4 Category Enzymes of known structure ...   more details



  1. C4H5N3O

    DISPLAYTITLE C sub 4 sub H sub 5 sub N sub 3 sub O The molecular formula C sub 4 sub H sub 5 sub N sub 3 sub O may refer to Cytosine Isocytosine MolFormDisambig ...   more details



  1. List of Y-DNA single-nucleotide polymorphisms

    tgtatctttagttgagatgg M368 Adenine A to Cytosine C 200 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M369 Guanine G to Cytosine C 45 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M370 Cytosine C ...   more details



  1. Deamination

    lesion by replacement with another cytosine. A Family A DNA Polymerase may perform this replacement ... the resulting nicked duplex product, which now includes a new, correct cytosine. See Base excision repair ..., selectively base pairs with thymine instead of cytosine . This results in a post replicative transition ... tautomer of adenine, selectively base pairs with cytosine instead of thymine . This results ...   more details



  1. Pyrimidone

    chembox verifiedrevid 385317369 Name 4 Pyrimidone ImageFile Pyrimidone.png ImageSize 120px IUPACName Pyrimidone OtherNames Hydroxypyrimidine Pyrimidinone Section1 Chembox Identifiers CASNo 51953 17 4 PubChem 20695 SMILES O C1NC NC C1 Section2 Chembox Properties C 4 H 4 N 2 O 1 Appearance White to light yellow powder Density MeltingPt 163 168 C BoilingPt Solubility Section3 Chembox Hazards MainHazards Respiratory system, eye, skin irritation FlashPt Autoignition Pyrimidone is the name given to either of two heterocyclic compound s with the formula Carbon C sub 4 sub Hydrogen H sub 4 sub Nitrogen N sub 2 sub Oxygen O 2 pyrimidone and 4 pyrimidone . The compounds can also be called 2 hydroxypyrimidine or 4 hydroxypyrimidine respectively, based on a Substitution reaction substituted pyrimidine , or 1,3 diazine , ring. Derivatives Derivatives of pyrimidone are the basis of many other biological molecules, including Nucleobases , such as cytosine Barbiturates , such as metharbital gallery File Cytosine chemical structure.png Cytosine File Metharbital.png Metharbital gallery See also Pyrimidine Category Pyrimidones Heterocyclic stub zh ...   more details



  1. Acytosiosis

    Orphan date February 2009 Acytosiosis is a rare genetic disorder . Causes Acytosiosis is caused by an autosomal recessive mutation on Chromosome 9 , which causes a defect in the enzyme Alpha cytosinase . ref Wynbrandt, James and Ludman, Mark The Encyclopedia of Genetic Disorders and Birth Defects Facts on File 2000 Special BookSources 9780816038091 ISBN 978 0 8160 3809 1 ref Symptoms Because of the complete lack of cytosine due to the defective Alpha cytosinase, DNA replication cannot occur. This means that any zygote with Acytosiosis will be unable to divide into multiple cells and will thus die. In most cases, the mother won t even know that she would have had a baby if it hadn t died from Acytosiosis. ref Narins, Brigham The Gale Encyclopedia of Genetic Disorders Gale Group 2005 Special BookSources 9781414403663 ISBN 978 1 4144 0366 3 ref Etymology The name Acytosiosis comes from a combination of the prefix a , meaning no or none , cytosine , and the suffix iosis , meaning disorder . References reflist Category Genetic disorders with no OMIM ...   more details



  1. 5-Methylcytosine

    from cytosine. In vivo 5 Methylcytosine is an Epigenetics epigenetic modification formed ... cytosines are methylated. While spontaneous deamination of cytosine forms uracil, which is recognized ... of a DNA base from cytosine C to thymine T can result in a Transition genetics transition mutation . In addition, active enzymatic deamination of cytosine or 5 methylcytosine by the APOBEC family of cytosine deaminases could have beneficial implications on various cellular processes as well as on organismal ... S.N., and Roa S. title Crosstalk between genetic and epigenetic information through cytosine ... 5 Methylcytosine to form thymine with use of reagents such as nitrous acid cytosine deaminates to uracil ... treatment, which deaminates cytosine residues this property is often exploited to analyze DNA cytosine ...   more details



  1. High-GC content bacteria

    High GC content bacteria are Gram positive bacteria with a high number of guanine and cytosine bases as compared to adenine and thymine . These bacteria are of the class Actinobacteria   ref NCBI Taxonomy browser, http www.ncbi.nlm.nih.gov Taxonomy Browser wwwtax.cgi?mode Undef&id 201174&lvl 3&lin f&keep 1&srchmode 1&unlock, accessed 3 13 07. ref . For more information, see GC content . References references bacteria stub Category Microbiology ...   more details



  1. Pyrimidine analogue

    Pyrimidine analogues are antimetabolite s which mimic the structure of metabolic pyrimidine s. Examples Examples include Fluorouracil 5 fluorouracil 5FU which inhibits thymidylate synthase . Floxuridine FUDR Cytosine arabinoside Cytarabine gallery Image Pyrimidin.svg Pyrimidine Image Fluorouracil.svg Fluorouracil Image Floxuridine.png Floxuridine Image Gemcitabine.png Gemcitabine gallery Chemotherapeutic agents Antivirals Nucleobases, nucleosides, and nucleotides Category Metabolism Category Pyrimidines chemistry stub pa sr Analogni pirimidini ...   more details



  1. Antileukemic drug

    Unreferenced date October 2008 Antileukemic drugs , Chemotherapy anticancer drugs that are used to treat one or more types of leukemia , include Mercaptopurine 6 Mercaptopurine 6 Thioguanine Aminopterin Arsenic trioxide Asparaginase Cladribine Clofarabine Cyclophosphamide Cytosine arabinoside Dasatinib Daunorubicin Decitabine Dexamethasone Etoposide Fludarabine Gemtuzumab ozogamicin Idarubicin Imatinib mesylate Interferon Interleukin 2 Melphalan Methotrexate Mitoxantrone Nelarabine Nilotinib Oblimersen Pegaspargase Pentostatin Prednisone Rituximab Tretinoin Vincristine pharma stub Category Leukemia ...   more details



  1. B recognition element

    The B recognition element ref cite journal author Lagrange T, Kapanidis AN, Tang H, Reinberg D, Ebright RH year 1998 journal Genes and Development volume 12 issue 1 pages 34 44 title New core promoter element in RNA polymerase II dependent transcription sequence specific DNA binding by transcription factor IIB pmid 9420329 doi 10.1101 gad.12.1.34 pmc 316406 ref BRE is a DNA sequence found in the promoter region of most genes in eukaryote s and Archaea . ref cite journal journal Proceedings of the National Academy of Sciences of the USA title The structural basis for the oriented assembly of a TBP TFB promoter complex year 1999 author Littlefield O, Korkhin Y, Sigler PB volume 96 issue 24 pages 13668 13673 pmid 10570130 doi 10.1073 pnas.96.24.13668 pmc 24122 ref The BRE is a cis regulatory element that is found immediately upstream of the TATA box , and consists of 7 nucleotide s. Overview The first two nucleotides of the BRE sequence can be either guanine or cytosine . The third nucleotide is either guanine or adenine . The next four nucleotides are always the same cytosine, guanine, cytosine, cytosine. G C G C G A C G C C. The Transcription Factor IIB TFIIB recognizes this sequence in the DNA, and binds to it. The fourth and fifth alpha helix alpha helices of TFIIB intercalate with the DNA Grooves major groove of the DNA at the BRE. TFIIB is one part of the preinitiation complex that helps RNA Polymerase II bind to the DNA. See also Promoter biology CAAT box Enhancer genetics Insulator genetics Initiator motif Transcription start site References reflist Transcription Category Gene expression Category Molecular biology genetics stub ...   more details



  1. CpG site

    Image Cytosine chemical structure.png thumb right upright Cytosine Image Phosphate formula.svg thumb right Phosphate Image Guanine chemical structure.png thumb Guanine CpG sites are regions of DNA where a cytosine nucleotide occurs next to a guanine nucleotide in the linear DNA sequence sequence of Base pair base s along its length. CpG is shorthand for C phosphate G , that is, cytosine and guanine separated by a phosphate , which links the two nucleoside s together in DNA. The CpG notation is used to distinguish this linear sequence from the CG base pair base pairing of cytosine and guanine. Cytosines in CpG dinucleotides can be methylated to form 5 methylcytosine . In mammals, methylating the cytosine within a gene can turn the gene off, a mechanism called epigenetics . Enzymes that add a methyl group are called DNA methyltransferase s. In mammals, 70 to 80 of CpG cytosines are methylated. ref name Jabbari2004 cite journal author Jabbari K, Bernardi G title Cytosine methylation and CpG, TpG CpA and TpA frequencies journal Gene volume 333 issue pages 143 9 year 2004 month May pmid 15177689 doi 10.1016 j.gene.2004.02.043 url http linkinghub.elsevier.com retrieve pii S0378111904000836 ref Unmethylated CpG sites can be detected by Toll Like Receptor 9 ref http iai.asm.org cgi content abstract 76 5 2123?maxtoshow &hits 10&RESULTFORMAT &fulltext fumigatus&searchid 1&FIRSTINDEX 30&resourcetype HWFIG ref TLR 9 on plasmacytoid dendritic cell s and B cell s in humans. This is used to detect intracellular viral, fungal, and bacterial pathogen DNA. Frequency in vertebrates CpG dinucleotides have long been observed to occur with a much lower frequency in the sequence of vertebrate genomes than would be expected due to random chance. For example, in a genome with 42 GC content e.g. the human genome , a pair of nucleotides consisting of cytosine followed by guanine would be expected ... with CpG cytosine methylation. ref cite journal author Scarano E, Iaccarino M, Grippo P, Parisi ...   more details



  1. Methylase

    A methylase is an enzyme that attaches a methyl group to a molecule. These are found in prokaryotes and eukaryotes. Bacteria use methylase to differentiate between foreign genetic material and their own, thus protecting their DNA from their own immune system. By placing a methyl group on a base of the recognition site of a restriction endonuclease , methylases prevent the enzyme from cleaving the bacterial DNA. ref Nelson Biology 12 2003 ref There are methylases that can methylate DNA, RNA, proteins, or small molecules, for example, DNA methyltransferase , which methylates cytosine cytosine residues and adenine adenine residues in DNA . A new relevant example is a methylase that alters the ribosomal RNA binding site of the antibiotic linezolid and causes cross resistance to other antibiotics which act on the ribosomal RNA. Plasmid vectors capable of transmitting this gene are a cause of potentially dangerous cross resistance. ref Morales G, Clin Infect Dis 2010 50 821 5 ref ref RC Moellering N Engl J Med 2010 363 2377 9 ref See also Demethylase References references transferase stub Category EC 2.1.1 fr M thylase ...   more details



  1. RNA-Directed DNA Methylation

    Technical date May 2010 RNA directed DNA methylation RdDM is an epigenetics epigenetic process first elucidated in plants whereby small double stranded RNA s dsRNA s are processed to guide methylation to complementary DNA locus genetics loci . In the model plant organism Arabidopsis thaliana , these small dsRNA s may be generated from three sources Viral replication intermediates Products of the endogenous RNA dependent RNA polymerase Transcribed inverted repeats These dsRNAs are then processed to direct histone 3 lysine 9 H3K9 methylation via Ago4 and the SUVH Suppressor of Variegation Homolog histone methyltransferase family. This H3K9 dimethylation is then putatively bound by the cytosine methyltransferase CMT3, which methylates cytosines in a non CG context. These marks, H3K9 dimethylation and cytosine methylation, are canonical marks of gene silencing . Thus small double stranded RNAs generated in diverse contexts bring about transcriptional silencing at specific loci. References http www.pnas.org content 99 suppl.4 16499.full.pdf PNAS 2004 Review Article http jcs.biologists.org cgi content abstract 117 21 4881 JCS 2004 Review Article http www.springerlink.com content n148797wh3124068 Hypothesis of initiation of DNA methylation de novo and allelic exclusion by small RNAs Categories DEFAULTSORT Rna Directed Dna Methylation Category Genetics ...   more details



  1. Ribonucleotide

    Unreferenced stub auto yes date December 2009 A ribonucleotide is a nucleotide in which a purine or pyrimidine base is linked to a ribose molecule . The base may be adenine A , guanine G , cytosine C , or uracil U . Note that thymine T , which is found in deoxyribonucleotides, is not found as a ribonucleotide in living beings. Ribonucleotides have one, two, or three phosphate groups attached to the ribose sugar. Ribonucleotides include adenosine triphosphate ATP , which is the major source of energy for cell work. Nucleobases, nucleosides, and nucleotides Category RNA Category Ribosides Biochem stub de Ribonukleotide es Ribonucle tido fr Ribonucl otide it Ribonucleotide nl Ribonucleotide oc Ribonucleotid pl Rybonukleotydy ru sr Ribonukleotid ...   more details



  1. Nucleoside triphosphate

    unreferenced date February 2007 Nucleoside triphosphate NTP is a nucleoside with three phosphate s. Natural nucleoside triphosphates include adenosine triphosphate ATP , guanosine triphosphate GTP , cytidine triphosphate CTP , thymidine triphosphate TTP and uridine triphosphate UTP . These terms refer to those nucleoside triphosphates that contain ribose. The nucleoside triphosphates containing deoxyribose take prefix deoxy in their names and small d in their abbreviations deoxyadenosine triphosphate dATP , deoxyguanosine triphosphate dGTP , deoxycytidine triphosphate dCTP , deoxythimidine triphosphate dTTP and deoxyuridine triphosphate . Check the entry nucleotide for table and description of these compounds. Apart from d ATP, d GTP, d CTP, d TTP and d UTP, there are other less abundant NTPs, such as intermediates of nucleotide metabolism, but also rare natural nucleotides or even artificial nucleotides . The rare NTP are tautomeric forms of the NTPs. They cause mismatched base pairing during DNA replication. For example, a tautomeric form of cytosine is capable of forming 3 h bonds with adenine, and it will spontaneously revert to its original cytosine form, causing a mismatch. By a similar token, the deamination of cytosine leads to uracil, whereas a deamination of a commonly encountered in eukaryotes 5 methylcytosine will lead to thymine. However, the 5 to 3 DNA replication ensures that these mismatched bases are excised. Nucleotide derivatives are of unparalleled importance for current natural life forms, as they are building blocks of nucleic acid s and have thousands of other roles in cell metabolism and regulation. ATP is a major source of cellular energy. GTP is a very frequent cofactor of enzymes and proteins. NTPs generally provide energy and phosphate group for phosphorylations. Generally nucleoside s are nucleotide s e.g. adenine, guanine, cytosine... that lack phosphates. However, for the sake of technical terminology , nucleotides are given classifica ...   more details



  1. HELP assay

    B, et al. title An analytical pipeline for genomic representations used for cytosine methylation ...   more details



  1. ACGT

    ACGT stands for the four nucleic acid bases that make up DNA . The A stands for Adenine and pairs with the T, which stands for Thymine . The C stands for Cytosine and pairs with the G, Guanine . These four nucleic acids make up a creature s genetic code, or DNA. ref name intro cite web title Introduction to Genes and DNA publisher Health Grades url http www.wrongdiagnosis.com genetics dna.htm year 2004 accessdate 2010 03 03 ref ACGU stands for the four amino acids that make up RNA . RNA pairs up the same as DNA, except that Thymine is replaced with Uracil . ref name intro References reflist genetics stub Category Acids ...   more details



  1. TRNA (cytosine-5-)-methyltransferase

    enzyme Name tRNA cytosine 5 methyltransferase EC number 2.1.1.29 CAS number 37256 97 6 IUBMB EC number 2 1 1 29 GO code 0016428 image width caption lowercase In enzymology , a tRNA cytosine 5 methyltransferase EC number 2.1.1.29 is an enzyme that catalysis catalyzes the chemical reaction S adenosyl L methionine tRNA math rightleftharpoons math S adenosyl L homocysteine tRNA containing 5 methylcytosine Thus, the two substrate biochemistry substrates of this enzyme are S Adenosyl methionine S adenosyl methionine and tRNA , whereas its two product chemistry products are S adenosylhomocysteine and tRNA containing 5 methyl cytosine . This enzyme belongs to the family of transferase s, specifically those transferring one carbon group methyltransferases. The systematic name of this enzyme class is S adenosyl L methionine tRNA cytosine 5 methyltransferase . Other names in common use include transfer ribonucleate cytosine 5 methyltransferase , and transfer RNA cytosine 5 methyltransferase . References reflist 1 cite journal author Hurwitz J, Gold M, Anders M date 1964 title The Enzymatic Methylation of Ribonucleic Acid and Deoxyribonucleic Acid. 3. Purification of Soluble Ribonucleic Acid Methylating Enzymes journal J. Biol. Chem. volume 239 pages 3462&ndash 3473 pmid 14245404 cite journal author Bjork GR, Svensson I date 1969 title Studies on microbial RNA. Fractionation of tRNA methylases from Saccharomyces cerevisiae journal Eur. J. Biochem. volume 9 pages 207&ndash 215 pmid 69267419 doi 10.1111 j.1432 1033.1969.tb00596.x cite journal author Keith JM, Winters EM, Moss B date 1980 title Purification and characterization of a HeLa cell transfer RNA cytosine 5 methyltransferase journal J. Biol. Chem. volume 255 pages 4636&ndash 4644 pmid 7372600 issue 10 transferase stub Category EC 2.1.1 Category Enzymes of unknown structure it TRNA citosina 5 metiltransferasi ...   more details



  1. Base analog

    A base analog is a chemical that can substitute for a normal nucleobase in nucleic acid s. A common example would be 5 bromouracil 5BU , the abnormal base found in the mutagenic nucleotide analog BrdU. When a nucleotide containing 5 bromouracil is incorporated into the DNA, it is most likely to pair with adenine however, it can spontaneously shift into another isomer which pairs with a different nucleobase , guanine . If this happens during DNA replication, a guanine will be inserted opposite the base analog, and in the next DNA replication, that guanine will pair with a cytosine. This results in a change in one base pair of DNA, specifically a Transition genetics transition mutation . Image 5bu 2.gif center thumb 500px Mutagenesis by 5BU See also Antimetabolite References Griffiths AJ, Wessler SR, Lewontin RC, Gelbart WM, Suzuki DT, Miller JH. Introduction to Genetic Analysis , 8th ed. New York W.H.Freeman and Co, 2005. Category DNA Category Genetics de Basenanaloga zh ...   more details



  1. Oxidative deamination

    Oxidative deamination is a form of deamination that generates oxoacid s in the liver . The presence of nitrous acid can cause Transition genetics transition mutations , by converting cytosine to uracil . ref http www.mun.ca biochem courses 3107 Topics Mutations.html Mutations & Mutagenesis Bot generated title ref ref http www.newton.dep.anl.gov newton askasci 1993 chem CHEM016.HTM Molecules and cancer Bot generated title ref In Urea cycle Glutamate is the only amino acid that undergoes rapid oxidative deamination. This process leads to 2 toxic products Hydrogen Peroxide Ammonia . See also Monoamine oxidase References references External links GPnotebook 1449525189 http www.elmhurst.edu chm vchembook 632oxdeam.html Diagram at elmhurst.edu Category Metabolism biochemistry stub ca Desaminaci oxidativa es Desaminaci n oxidativa it Deaminazione ossidativa ru ...   more details



  1. ICE chemotherapy regimen

    Orphan date February 2009 ICE is a combination chemotherapy regimen employing three drugs ifosfamide i fosfamide trade name Ifex , carboplatin c arboplatin trade name Paraplatin , and etoposide e toposide trade names VP 16, VePesid . This regimen is commonly used to treat primary progressive and poor risk recurrent lymphoma s. ref Follow up Care & Relapse. Lymphoma Research Foundation. http www.lymphoma.org site pp.aspx?c chKOI6PEImE&b 1574015&printmode 1 ref In the last few years, it has become more common to include the drug rituximab alongside the ICE protocol. Rituximab is a monoclonal antibody which binds to and helps destroy B cell s. ref Trial of Oxaliplatin, Cytosine Arabinoside, Dexamethasone With Rituxan ROAD in Patients With Relapsed Non Hodgkins Lymphoma. ClinicalTrials.gov. http clinicaltrials.gov show NCT00166439 ref References reflist DEFAULTSORT Ice Chemotherapy Regimen Category Cancer treatments Category Chemotherapeutic agents ...   more details



  1. Nucleobase Cation Symporter

    Pfam box Symbol Transp cyt pur Name Permease for cytosine purines, uracil, thiamine, allantoin image width caption Pfam PF02133 InterPro IPR001248 SMART Prosite SCOP TCDB 2.A.39 OPM family 67 OPM protein 2x79 PDB The Nucleobase Cation Symporter 1 NCS1 family consists of bacterial and yeast transporters for nucleobases including purines and pyrimidines . Members of this family possess twelve transmembrane a helical spanners TMSs . At least some of them have been shown to function in uptake by substrate H symport mechanism. See also InterPro IPR012681 and InterPro IPR012732 . Category Protein domains Category Protein families Category Membrane proteins membrane protein stub InterPro content IPR001248 ...   more details



  1. Nucleobase

    Natl Acad Sci U S A. 1992 April 1 89 7 3030 3034 ref In similar manner, deamination of cytosine results ... . The skeleton of cytosine, uracil, and thymine is pyrimidine , hence pyrimidine bases . Primary ... Chemical structure of thymine br Thymine Image Cytosine chemical structure.png 51px Chemical structure of cytosine br Cytosine Image Uracil chemical structure.png 51px Chemical structure of uracil br ...   more details




Articles 1 - 25 of 342          Next


Search   in  
Search for Cytosine in Tutorials
Search for Cytosine in Encyclopedia
Search for Cytosine in Videos
Search for Cytosine in Books
Search for Cytosine in Software
Search for Cytosine in DVDs
Search for Cytosine in Store


Advertisement




Cytosine in Encyclopedia
Cytosine top Cytosine

Home - Add TutorGig to Your Site - Disclaimer

©2011-2013 TutorGig.com. All Rights Reserved. Privacy Statement