Sanger . The AsilomarConference on RecombinantDNA was an influential academic conferenceconference organized by Paul Berg ref First recombinantDNA. The Human Genome Project. http www.genome.gov ... Statement of the AsilomarConference on RecombinantDNA Molecules . Proc. Nat. Acad. Sci. Vol. 72, No. 6 ... and Genetic Experimentation . Madison University of Wisconsin Press, 1985 ref AsilomarConference Established principles The AsilomarConference on RecombinantDNA took place at the AsilomarConference ... Statement of the AsilomarConference on RecombinantDNA Molecules . Proc. Nat. Acad. Sci. Vol ... Paul Berg. Use dmy dates date September 2010 DEFAULTSORT AsilomarConference On RecombinantDna ... to ensure the safety of recombinantDNA technology. The conference also placed scientific research ... experiments using recombinantDNA technology, which entailed combining DNAs from different organisms. ref name asilomar ref name recombinant After the establishment of the guidelines during the conference ... of the conference was to address the biohazards presented by recombinantDNA technology. During the conference .... Additionally, the conference along with public debates on recombinantDNA, increased public interest ...File Paul Berg in 1980.jpg thumb right Paul Berg , a leading researcher in the field of recombinantDNA ... held in February 1975 at a conference center Asilomar State Beach . ref name asilomar Paul ... F. Singer. The recombinantDNA controversy Twenty years later . Proc. Natl. Acad. Sci. Vol 92 ... recombinantDNA technology RecombinantDNA technology arose as a result of advances in biology ... capacities to manipulate DNA. ref Susan Wright. RecombinantDNA Technology and Its Social Transformation ... recombinantDNA technology was a biochemist at Stanford by the name of Paul Berg. ref Paul Berg and Maxine F. Singer. The recombinantDNA controversy Twenty years later . Proc. Natl. Acad. Sci ... technology. This committee, called the Committee on RecombinantDNA molecules of the National Academy ... more details
is now biosynthetic recombinant human insulin or its analogs. See also Asilomarconference on recombinantDNA List of recombinant proteins The Non GMO Project Recombinant virus Vector DNA Notes reflist ...RecombinantDNA rDNA is a form of artificial DNA that is created by combining two or more Nucleic acid ... isbn0 7167 8724 5 A recombinant protein is a protein that is produced from recombinantDNA. ref ..., the use of recombinantDNA provides the initial cell from which the host organism is then expected ... due to the use of viral vector s in medicine that contain recombinantDNA inserted into a structure ... of cells with the recombinantDNA present within them. The use of plasmids is also key within ... of transporting and passing on genes in recombinantDNA through viral reproduction throughout an organism ... foreign DNA into the genomes of many plants. Other methods of introducing or creating recombinant ... blunt ends via the enzyme, T4 Ligase. When recombinantDNA is then further altered or changed to host ... Nathan P. Kaplan, Nathan P. Colowick, Ray Wu title RecombinantDNA, Volume 68 Volume 68 Recombinant ... proteins that are created from recombinantDNA and used as medication s. Some ... used as medication, only has recombinantDNA as a source, such as with erythropoietin . History The recombinant ..., creating a Transgenic Bacteria transgenic bacterium . Exploitation of recombinantDNA technology ... in the application of recombinantDNA technology occurred in 1977 when Herbert Boyer produced ... colony of the E. coli bacteria. It was the first medicine made via recombinantDNA technology ... cgi content abstract 219 4585 632 Human insulin from recombinantDNA technology Johnson ... first2 O. N. title Methods in Enzymology Volume 68 RecombinantDNA publisher Academic Press year ... http www.unh.edu ehs pdf Recombinant DNA.pdf Fact Sheet Describing RecombinantDNA and Elements Utilizing RecombinantDNA Such as Plasmids and Viral Vectors, and the Application of RecombinantDNA ... more details
Enzo Paoletti and Dennis Panicali at the New York State department of Health, devised a Strategy to produce recombinant DNA vaccines by using genetic engineering techniques. They were able to transform ordinary smallpox vaccine into vaccines that may be able to prevent other diseases. What Paoletti and his colleague, Virologist Dennis Panicali, set out to do was to alter the DNA of cowpox virus by inserting a gene from another virus namely herpes, hepatitis B or influenza . These efforts resulted, amongst others in the development of a commercial Hepatitis B vaccine which is now widely used. ref References ref http www.time.com time magazine article 0,9171,921366,00.html Time Magazine article on Paoletti s work http www.thefreelibrary.com A vaccine for all seasons 3B genetic engineering is remodeling the... a03815488 Article on Paoletti s work http www.thefreelibrary.com A vaccine for all seasons 3B genetic engineering is remodeling the... a03815488 Paoletti s vaccine for herpes Category Italian inventions references Paoletti, Enzo, Bernard R. Lipinskas, Carol Samsonoff, Susan Mercer, and Dennis Panicali 1984 Construction of Live Vaccines Using Genetically Engineered Poxviruses Biological Activity of Vaccinia Virus Recombinants Expressing the Hepatitis B Virus Surface Antigen and the Herpes Simplex Virus Glycoprotein D Proc. Natl. Acad. Sci. USA 81 193 197 Panicali, Dennis, Stephen W. Davis, Randall L. Weinberg, Enzo Paoletti 1983 Construction of Live Vaccines by Using Genetically Engineered Poxviruses Biological Activity of Recombinant Vaccinia Virus Expressing Influenza Virus Hemagglutinin Proc. Natl. Acad. Sci. USA 80 5364 5368 US Patent 4722848 Method for immunizing animals with synthetically modified vaccinia virus ... more details
Conferences 1975 Asilomarconference on recombinantDNA 2010 Asilomar international conference ...Infobox nrhp name AsilomarConference Grounds nrhp type nhl image Merrill Hall Asilomar edit1.jpg caption Merrill Hall, Asilomar location 800 Asilomar Avenue, Pacific Grove, California , USA locmapin California area convert 107 acre km2 ref http www.visitasilomar.com ParkInfo.aspx Asilomar Park Information ref lat degrees 36 lat minutes 37 lat seconds 11 lat direction N long degrees 121 long minutes 55 long seconds 53 long direction W locmapin California built 1913 architect Julia Morgan , architecture Arts and Crafts Movement and American craftsman style Bungalow s designated nrhp type February 27, 1987 ref name nhlsum cite web url http tps.cr.nps.gov nhl detail.cfm?ResourceId 1986&ResourceType District title AsilomarConference Grounds accessdate 2008 02 18 work National Historic Landmark summary listing publisher National Park Service ref added February 27, 1987 ref name nris NRISref 2007a ref governing body State refnum 87000823 AsilomarConference Grounds is a conference center built for the YWCA in 1913 in Pacific Grove, California . Julia Morgan designed and built 16 of the buildings ... Julia Morgans influence ref It became part of Asilomar State Beach and Conference Grounds in 1955. Asilomar is a derivation of the Spanish phrase asilo al mar , meaning asylum or refuge by the sea ..., the grounds became part of the larger California state park known as Asilomar State Beach and Conference Grounds . The property is currently used as a conference center open to the public. It is run ... www.visitasilomar.com asilomartoday.aspx AsilomarConference Grounds Asilomar Today ref To preserve ... retreats burned down. Phoebe Apperson Hearst hosted the 1912 conference at one of her estates ... Asilomar history ref The winning entry in the naming contest was by Helen Salisbury, a Stanford ... Asilomar Website Registered Historic Places Category National Historic Landmarks in California ... more details
notability date December 2010 The AsilomarConference Grounds Asilomar International Conference of Geoengineering Climate Intervention Technologies was a academic conferenceconference developed by Dr. Margaret Leinen of the Climate Response Fund and chaired by Dr. Michael MacCracken of the Climate Institute. The conference took place in March 2010 and the recommendations were published in November 2010. The goal was identify and minimize risks geoengineering similar to the 1975 AsilomarConference on RecombinantDNA which discussed the potential biohazards and regulation of biotechnology. A group of over 150 scientist and engineers gathered together with lawyers, environmentalists and disaster relief workers in an open meeting to avoid accusations of consipiracy during this discussion ref http www.cbc.ca video Shows Doc Zone 1242299559 ID 1664956266 CBC.ca Player Bot generated title ref . The AsilomarConference focused exclusively on the development of risk reduction guidelines for climate intervention experiments ref name climateresponsefund.org http climateresponsefund.org index.php?option com content&view article&id 137&Itemid 81 Conference Home Bot generated title ref . Goals of the Conference ref name climateresponsefund.org Identify potential risks associated with climate intervention experiments Propose a system to assess experiment design for potential categorical risks and suggest precautions to assure their safe conduct Propose voluntary standards for climate intervention ... ref http www.scribd.com doc 25251727 The Asilomar International Conference On Climate Intervention Geoengineering Technologies 2010 The Asilomar International Conference On Climate Intervention ... 137&Itemid 81 http climateresponsefund.org images Conference finalfinalreport.pdf DEFAULTSORT Asilomar International Conference On Climate Intervention Technologies Category Global warming Category ... images Conference finalfinalreport.pdf ref The core rationale for pursuit of climate engineering ... more details
Asilomar can refer to a number of things Asilomar State Beach &ndash a beach in California, home to the AsilomarConference Grounds Asilomar International Conference on Geoengineering Climate Intervention Technologies in March 2009 Asilomarconference on recombinantDNA &ndash an influential conference on the regulation of biotechnology held at the Asilomarconference center in 1975 Asilomarconference on geoengineering a conference on the regulation of geoengineering held at the Asilomarconference center in 2010 AsilomarConference Grounds disambig ... more details
Recombinant may refer to A recombinant organism an organism that contains a different combination of Allele alleles from either of its parents. RecombinantDNA a form of artificial DNARecombinant virus a virus formed by recombining genetic material VRLA , a valve regulated lead acid VRLA battery that is also referred to as a recombinant battery InSoc Recombinant , an album by synthpop band Information Society See also Recombination disambiguation disambig de Rekombinant ... more details
A recombinant virus is a virus produced by recombining pieces of DNA using recombinantDNA technology. This may be used to produce vaccine viral vaccine s or gene therapy vectors. It is also used to refer to naturally occurring recombination between virus genomes in a cell infected by more than one virus strain. This occurs either by homologous crossing over of the nucleic acid strands or by reassortment of genomic segments. Both these and mutation within the virus have been suggested as ways in which influenza and other viruses evolve. Reassortment is most important for pandemic influenza viruses. See also Reassortment Mutation References http www.cdc.gov ncidod eid vol10no4 03 0396.htm Recombination Resulting in Virulence Shift in Avian Influenza Outbreak, Chile. Suarez et al 2009 http mbe.oxfordjournals.org cgi content abstract 26 1 177?maxtoshow &HITS 1&hits 1&RESULTFORMAT &andorexacttitle phrase&titleabstract H5N1&andorexacttitleabs and&andorexactfulltext and&searchid 1&usestrictdates yes&resourcetype HWCIT&ct Homologous Recombination as an Evolutionary Force in the Avian Influenza A Virus. He at al 2008 External links http www.pbs.org wgbh amex influenza sfeature drjeffrey8.html Dr. Jeffery Taubenberger on A Recombinant Virus http crisp.cit.nih.gov Thesaurus 00006973.htm Recombinant virus http pathmicro.med.sc.edu mhunt genet.htm Viral Genetics http www.cdc.gov flu avian gen info transmission.htm Transmission of Influenza A Viruses Between Animals and People Virus topics DEFAULTSORT Recombinant Virus Category Virology Category Influenza Category Microbiology ... more details
Infobox Album See Wikipedia WikiProject Albums Name InSoc Recombinant Type Remix Artist Information Society band Information Society Cover Released April 6, 1999 Recorded Genre Synthpop Length Label Cleopatra Records Cleopatra Producer Reviews Last album Don t Be Afraid album Don t Be Afraid br 1997 This album InSoc Recombinant br 1999 Next album strange haircuts cardboard guitars and computer samples br 2001 InSoc Recombinant is a compilation album of the greatest hits by synthpop band Information Society band Information Society , in various remix remixed versions. It includes, as a bonus, a CD ROM with five music videos. Track listing What s on Your Mind Pure Energy CKB Remix Closing In Rosetta Stone band Rosetta Stone Mix Peace & Love, Inc. Biokraft Mix Think Information Society song Think Spahn Ranch band Spahn Ranch Mix What s on Your Mind? Pure Energy Girl Eats Boy Mix Walking Away Le ther Strip Mix Going Going Gone Razed in Black Mix What s on Your Mind? Pure Energy Judson Leach and the Exhibition Mix Empty Astralasia Mix Ending World Electric Hellfire Club Mix On the Outside THC band THC Mix What s on Your Mind? Pure Energy David J Remix The Brazilian release included InSoc s cover of Madonna entertainer Madonna s Express Yourself Madonna song Express Yourself previously released in the compilation Virgin Voices A Tribute To Madonna . http www.insoc.com.br mix recomb.php All the remixes of What s On Your Mind? Pure Energy were previously released on a 12 single the year before. Video listing What s on Your Mind Pure Energy Walking Away Repetition Think Peace & Love, Inc Category Information Society albums Category 1999 remix albums 1990s electronic album stub 1990s compilation album stub ... more details
instead of phosphorus in DNA . A December 2010 NASA press conference revealed that the bacterium ...File DNA Structure Key Labelled.png thumb right 340px The structure of the DNA double helix . The atoms ... ADN animation.gif thumb The structure of part of a DNA double helix Deoxyribonucleic acid IPA en di ksi ra b .nju kle . k s d en us Deoxyribonucleic acid.ogg , or DNA , is a nucleic acid that contains ... organism s with the exception of RNA virus es . The main role of DNA molecule s is the long term storage of information . DNA is often compared to a set of blueprint s, like a recipe or a code, since ... s and RNA molecules. The DNA segments that carry this genetic information are called gene s, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. DNA consists of two long polymers of simple units called nucleotide s, with backbone ... is read by copying stretches of DNA into the related nucleic acid RNA, in a process called transcription genetics transcription . Within cells, DNA is organized into long structures called chromosome s. These chromosomes are duplicated before cells cell division divide , in a process called DNA ... most of their DNA inside the cell nucleus and some of their DNA in organelle s, such as mitochondria ... store their DNA only in the cytoplasm . Within the chromosomes, chromatin proteins such as histone s compact and organize DNA. These compact structures guide the interactions between DNA and other proteins, helping control which parts of the DNA are transcribed. Properties File DNA chemical structure.svg thumb 300px Chemical structure of DNA. Hydrogen bond s shown as dotted lines. DNA is a long polymer ... 57023651 69932405 ref ref name Butler cite book author Butler, John M. year 2001 title Forensic DNA ... by James D. Watson and Francis Crick , the structure of DNA of all species comprises two helical ... solution, the DNA chain measured 22 to 26 ngstr m s wide 2.2 to 2.6 nanometre s , and one ... more details
Image A DNA orbit animated small.gif right frame The A DNA structure. A DNA is one of the many possible double helical structures of DNA . A DNA is thought to be one of three biologically active double helical structures along with B DNA B and Z DNA . It is a right handed double helix fairly similar to the more common and well known B DNA form, but with a shorter more compact helical structure. It appears likely that it occurs only in dehydrated samples of DNA, such as those used in crystallographic experiments, and possibly is also assumed by DNA RNA hybrid helices and by regions of double stranded RNA. Structure A DNA is fairly similar to B DNA given that it is a right handed double helix with major ... turn. This results in a deepening of the major groove and a shallowing of the minor. Predicting A DNA structure An algorithm for predicting the propensity of a sequence to flip from B DNA to A DNA ... cite journal author Basham B, Schroth GP, Ho PS title An A DNA triplet code thermodynamic rules for predicting A and B DNA journal Proc Natl Acad Sci USA volume 92 issue 14 pages 6464 6468 year ... in the hydration of DNA surfaces can be used to distinguish between sequences that form A and B DNA. From this, a triplet code of A DNA propensities was derived as energetic rules for predicting A DNA formation. This code correctly predicted 90 of A and B DNA sequences in crystals and correlates with A DNA formation in solution. Thus, with our previous studies on Z DNA, we now have a single method to predict the relative stability of sequences in the three standard DNA duplex conformations. ref name Basham1995 cite journal author Basham B, Schroth GP, Ho PS title An A DNA triplet code thermodynamic rules for predicting A and B DNA journal Proc Natl Acad Sci USA volume 92 issue 14 pages ... of the Most Common DNA Forms Image A DNA, B DNA and Z DNA.png right thumb Side view of A , B , and Z DNA. Image B&Z&A DNA formula.jpg thumb right 250px The helix axis of A , B , and Z DNA. class ... more details
Infobox animanga Header name DNA image caption ja kanji D N A ja romaji D En Ei Ts Dokoka de Nakushita Aitsu no Aitsu genre Harem genre Harem , Science fiction Infobox animanga Print type manga author Masakazu Katsura publisher Shueisha publisher other flagicon FRA Editions Tonkam br flagicon GER Carlsen Comics br flagicon MEX Grupo Editorial Vid br flagicon ESP Planeta DeAgostini Comics br flagicon BRA Editora JBC demographic Sh nen manga Sh nen magazine Weekly Sh nen Jump first 1993 last 1994 volumes 5 volume list Infobox animanga Video type tv series director Jun ichi Sakata producer writer music studio Madhouse company Madhouse br Studio Deen network Animax , Nippon Television network other flagicon KOR Animax first 7 October 1994 last 23 December 1994 episodes 12 episode list Infobox animanga Video type ova director Jun ichi Sakata producer writer music studio Madhouse company Madhouse br Studio Deen released 1995 runtime episodes 3 episode list Infobox animanga Footer nihongo DNA D N A D En Ei Ts Dokoka de Nakushita Aitsu no Aitsu is a science ... 100 children that carry the Mega Playboy DNA, causing them and all their descendants to each have 100 ... to deal with. Karin reveals to Junta that she is a DNA Operator . Her job is to make alterations in people s DNA that will change their nature for the greater good of society. She intends to shoot the original Mega Playboy with a DCM DNA Control Medicine bullet that will alter his DNA in order ... DCM bullet. However, each time he transforms, his Mega Playboy DNA stabilizes more and more. nihongo Karin Aoi Aoi Karin anime voices Miina Tominaga Jessica Calvello A sixteen year old DNA ... Never Forget You Manga The DNA manga was published in Japanese magazine Weekly Sh nen Jump 1993 No. 36 ... es ca DNA cs DNA de DNA es DNA fr DNA ko DNA id DNA it DNA ja D N A pt DNA ru DNA fi DNA sv DNA tl DNA zh DNA ... more details
rocks and big sets are staples of this area. Asilomar State Beach incorporates AsilomarConference ... of National Historic Places. ref http www.visitasilomar.com destination.aspx AsilomarConference Grounds Destination ref The beach does not feature a bathroom facility. The nearest bathroom is in the AsilomarConference grounds, at the main hall, the Phoebe Hearst Social Hall, just across the road ...refimprove date February 2008 Infobox Protected area name Asilomar State Beach iucn category photo RedwoodPlanks AsilomarStateBeach.jpg photo caption Walkway made of redwood planks along the beach location Pacific Grove, California Pacific Grove , California nearest city lat d 36 lat m 37 lat s 12 lat NS N long d 121 long m 56 long s 16.8 long EW W area established visitation num visitation year governing body California Department of Parks and Recreation Asilomar State Beach is located on the Monterey Peninsula in the city of Pacific Grove, California , USA. Asilomar meaning refuge by the sea and pronounced a SIL o mar State Beach and Conference Grounds sits on 107 acres 433,000 m and offers overnight lodging and views of the forest, surf and sand. Asilomar State Beach is a narrow one mile ... to pedestrians. This trail is wheelchair accessible, and beach wheelchairs are available at Asilomar State Beach. ref http www.seemonterey.com pacific grove california asilomar state beach Monterey County Convention and Visitors Bureau Asilomar State Beach ref Bicycling is allowed on the paved bike lane in proximity to the trail. The ocean off shore are protected as the Asilomar State Marine ... accessdate December 5, 2010 ref Image Plants Asilomar State Beach cropped.JPG left thumb Plants that grow at Asilomar State Beach The water in the vicinity of Asilomar State Beach is rather free ... the Asilomar property, and it is a restful, natural, wooded property to walk around. See also List ... www.parks.ca.gov default.asp?page id 566 Asilomar State Beach , State of California Protected Areas ... more details
Asilomar State Marine Reserve SMR is one of four small marine protected areas MPAs located near the cities of Monterey and Pacific Grove, California Pacific Grove , at the southern end of Monterey Bay on California s central coast. The four MPAs together encompass convert 2.96 mi2 . The SMR protects all marine life within its boundaries. Fishing and take of all living marine resources is prohibited. ref name guide cite book title Guide to the Central California Marine Protected Areas Pigeon Point to Point Conception date September 2007 publisher California Department of Fish and Game url http www.dfg.ca.gov mlpa pdfs ccmpas guide.pdf accessdate December 5, 2010 ref History The Asilomar State Marine Reserve was established in September 2007 by the California Fish and Game Commission. It was one of 29 marine protected areas adopted during the first phase of the Marine Life Protection Act Initiative, which created a statewide network of marine protected areas along the California coastline. The reserve helps protect some of the central coast s most heavily used and accessible areas near the shore while leaving most of the coastal waters open for continued fishing. ref name guide Geography and natural features Asilomar SMR is located off the coast of the Monterey Peninsula , at the southern ... from Asilomar State Beach . Asilomar SMR is the westernmost of four marine protected areas bordering ... the following points in the order listed coord 36 38.22 N 121 56.15 W name Asilomar SMR boundary point 1 , coord 36 38.90 N 121 56.60 W name Asilomar SMR boundary point 2 and coord 36 36.60 N 121 57.50 W name Asilomar SMR boundary point 3 . ref name guide Habitat and wildlife The Monterey Peninsula ... , and dense kelp bed s offshore provide shelter for sea otters . The Asilomar SMR provides habitat ... watching, tidepooling and walking on the beach. Asilomar State Beach, adjacent to the reserve, offers ... External links http www.parks.ca.gov ?page id 566 Asilomar State Beach http www.piscoweb.org ... more details
A recombinant inbred strain or recombinant inbred line is an organism with chromosomes that incorporate an essentially permanent set of recombination events between chromosomes inherited from two or more inbred strain s. Families of recombinant inbred strains numbering from 25 to 5000 are often used to map the locations of DNA sequence differences quantitative trait loci that contributed to differences in phenotype in model organisms. Recombinant inbred strains or lines were first developed using ... melanogaster , C. elegans, and rat. History The origins and history of recombinant inbred strains ..., Taylor and recombinant inbred lines. journal Genetics year 2007 volume 176 pages 729 732 pmid 17579238 url http www.genetics.org cgi content full 176 2 729 ref . While the potential utility of recombinant ... quasi Mendelian loci . One of the initial motivations to use recombinant inbred strains was that expensive ... genotyping became much easier and recombinant inbred strains lost this advantage. The main advantage ... research projects in predictive medicine . Use Recombinant inbred strains are now widely ... extensive genetic and phenotype data for each member of a family of recombinant inbred strains under .... Genetics Chromosomes of recombinant inbred strains typically consist of alternating haplotypes ... of a typical mouse recombinant inbred strain made by crossing maternal strain BALB cBy C with paternal strain C57BL 6By B called a CXB recombinant inbred strain, a chromosome will typically incorporate ... of centimorgan or DNA basepair position. The precision with which these recombinations are mapped ... above. Mapping All else being equal, the larger the family of recombinant inbred strains, the greater ... larger families of recombinant inbred strains were generated concurrently by Benjamin Taylor to map Mendelian and other major effect loci. In the 1990s the utility of recombinant inbred strains for mapping ... markers. Between 2005 and 2007, virtually all extant mouse and rat recombinant inbred ... more details
Following is a list of notable proteins that are generated from recombinantDNA . Since human recombinants have replaced the animal version in human therapeutics, the prefix of rh for human recombinant appears less and less in the literature Human recombinants that largely replaced animal or harvested from human types Growth hormone Human growth hormone rHGH Humatrope from Eli Lilly and Company Lilly and Serostim from Serono replaced cadaver harvested human growth hormone Biosynthetic Insulin human insulin BHI Humulin from Eli Lilly and Company Lilly and Novolin from Novo Nordisk among others largely replaced bovine and porcine insulin for human therapy. Some prefer to continue using the animal sourced preparations, as there is some evidence that synthetic insulin varieties are more likely to induce Diabetic hypoglycemia Hypoglycemic unawareness hypoglycemia unawareness . Remaining manufacturers of highly purified animal sourced insulin include the U.K. s Wockhardt Ltd. headquartered in India , Poland s Polfa Tarchomin S.A., Argentina s Laboratorios Beta S.A., and China s Wanbang Biopharma Co. Follicle stimulating hormone FSH as a recombinant gonadotropin preparation replaced Serono s Pergonal which was previously isolated from post menopausal female urine Factor VIII Kogenate from Bayer replaced blood harvested factor VIII Human recombinants with recombination as only source Erythropoietin EPO Epogen from Amgen Granulocyte colony stimulating factor G CSF filgrastim sold as Neupogen from Amgen pegfilgrastim sold as Neulasta alpha glactosidase A Fabrazyme by Genzyme alpha L iduronidase rhIDU laronidase Aldurazyme by BioMarin Pharmaceutical and Genzyme N acetylgalactosamine 4 sulfatase rhASB galsulfase Naglazyme TM by BioMarin Pharmaceutical Dornase alfa , a DNase sold under the trade name Pulmozyme by Genentech Tissue plasminogen activator TPA Activase by Genentech Glucocerebrosidase Ceredase by Genzyme Interferon IF Interferon beta 1a as Avonex from Biogen Idec Rebif ... more details
Orphan date November 2006 Recombinant Human Dragon is an internet based multimedia installation exploring issues of cultural ownership and re use. It is also home to the musical artists Beastmaster Romance and The Earl of Bandwidth . Manifesto excerpts We too often confuse doing an activity with being entertained. We too readily accept passive entertainment as a substitute for active participation in culture, consumption as a substitute for production. We too often convince ourselves to be satisfied with cultural opportunities which ask us to invest nothing other than money. The project of recombinant cultural production asserts the necessity of hybrids, the impossibility of inventing anything completely new. Works of culture always borrow from, build off of, and make reference to past works, whether they like it or not. Originality is a myth that belongs with the epic works of 19th romanticism. Leave it there. You cannot create something from nothing. One needs raw materials. The process of creation requires appropriation. Influences Dadaism Situationist International Situationism External links http recombinanthumandragon.com Recombinant Human Dragon Website Category Artist groups and collectives Artist stub ... more details
Orphan date February 2011 New unreviewed article source ArticleWizard date January 2011 The Recombinant Immunotoxin Collaborative Group RICG is a group of scientists specialising in immunology, biochemistry and molecular biology from the United Kingdom and Italy. The group is working toward the development of genetically engineered immunotoxins made from monoclonal antibody fragments genetically fused to either saporin or Pseudomonas exotoxin PE for the treatment of human hematological malignancies such as leukaemia , lymphoma and multiple myeloma . The RICG was formed in 2005 and originally consisted of Dr Aldo Ceriotti and Dr M. Serena Fabbrini IBBA, CNR, Milan , Professor Marco Colombatti University of Verona , Professor Rodolfo Ippoliti University of L Aquila , Dr Alessandro Pini University of Siena and Drs David Flavell & Sopsamorn Flavell University of Southampton Medical School & Leukaemia Busters . Dr Alessandro Pini left the group in 2007. The RICG was successful in producing a range of recombinant immunotoxins based on the monoclonal antibodies 4KB128 and OKT10 targeting CD22 and CD38 , respectively on normal and malignant lymphoid cells. This development work was undertaken with funding from the UK based charity Leukaemia Busters ref http leukaemiabusters.org.uk ref under the direction of Dr David Flavell , the charity s Scientific Director ref http www.leukaemiabusters.org.uk pages background.aspx ref The group disbanded in 2009 due to funding difficulties following the global economic crisis but despite this the former members continue to collaborate in areas of mutual interest. In this respect some of the group members and their respective institutes have recently entered into a collaboration agreement with the Italian pharmaceutical company Domp ref http www.dompe.com website ref based in L Aquila, central Italy with the intention of developing one of the RICG produced recombinant immunotoxins for investigation in early phase clinical trials for patients ... more details
of DNA repair nucleotide excision repair and recombinant fragments. LIG4 DNA ligase IV complexes ... molecular biology research for generating RecombinantDNArecombinantDNA sequences. For example, DNA ...Refimprove date February 2007 enzyme Name DNA ligase EC number 6.5.1.1 CAS number 9015 85 4 IUBMB EC number 6 5 1 1 GO code 0003910 image DNA Ligase.jpg width caption DNA ligase I protein Name ligase I, DNA, ATP dependent caption image width 200 HGNCid 6598 Symbol LIG1 AltSymbols EntrezGene 3978 OMIM ... Name ligase III, DNA, ATP dependent caption image width HGNCid 6600 Symbol LIG3 AltSymbols EntrezGene ... LocusSupplementaryData q12 protein Name ligase IV, DNA, ATP dependent caption image width HGNCid 6601 ... 13 Arm q Band 33 LocusSupplementaryData q34 In molecular biology , DNA ligase is a special ... in double stranded DNA molecules, in simple words strands that have double strand break a break in both complementary strands of DNA . Purified DNA ligase is used in gene cloning to join DNA ... type of DNA ligase using the Complementary DNA complementary strand as a template Citation needed date April 2010 but still requires DNA ligase to create the final phosphodiester bond to fully repair the DNA. DNA ligase has applications in both DNA repair and DNA replication see DNA ligase Mammalian ligases Mammalian ligases . In addition, DNA ligase has extensive use in molecular biology laboratories for Genetic recombination experiments see DNA ligase Applications in molecular biology research Applications in molecular biology research . Ligase mechanism The mechanism of DNA ligase is to form ... and the 3 hydroxyl of the acceptor. ref name pmid4377758 cite journal author Lehman IR title DNA ligase ... a ligase works with DNA end sticky end s Image Ligation.svg 400px Ligase will also work with DNA end ... ligases This section is linked from DNA ligase In mammals, there are four specific types of ligase. LIG1 DNA ligase I ligates the nascent DNA of the Replication fork Lagging strand lagging strand ... more details
DNA to transform cells has spawned the discipline of transgenesis the use of recombinantDNA techniques ...Unreferenced date February 2007 Exogenous DNA refers to any DNA deoxyribonucleic acid that originates outside of the organism of concern or study. The introduction of exogenous DNA into a cell is called transfection . This can take place naturally, as occurs when a virus infects cells, or artificially. Methods of artificial transfection include a chemical methods, including calcium phosphate precipitation, DEAE dextran complexation and lipid mediated DNA transfer b physical methods, including electroporation, microinjection, and biolistic particle delivery gene gun and c using recombinant, lab manipulated viruses as vectors. The process by which cells take up exogenous DNA from the outside is called Transformation genetics transformation . Bacteria need to be in a certain physiological state to successfully take up exogenous DNA, which is described as one of competence. Some bacteria are naturally competent, but usually only for a brief time at a certain stage of their growth cycle. Bacteria can also be made competent through a variety of chemical treatments including exposure to calcium ions, or a mixture of polyethylene glycol and dimethylsulfoxide, which make the cell membrane more permeable, leading to the uptake of the exogenous DNA. Another treatment method is the ustilisation of electricity as the membrane permeabilizing agent electroporation or electrotransformation . Finally, liposome mediated transformation can be used. In this method DNA is coated with lipid. Fusion of this lipid and the membrane lipid can occur, facilitating the entry of DNA. Transformation of bacteria ... of exogenous DNA is used to identify genes because the introduced DNA can act cause a mutation ..., often employs retrovirus es as the vectors of DNA delivery. Such insertion mutagenesis has ... rejection. Category DNA ... more details
Summary Information Description Flora at Asilomar State Beach Source My picture I cropped out the date stamp Date July 11 2008 Author User Intothewoods29 Intothewoods29 User talk Intothewoods29 talk other versions Licensing PD self date August 2008 ... more details
www.ancientDNA9.it ancientDNA9 The 9th International Conference on Ancient DNA and Associated Biomolecules ... DNA.png thumb Cross linked DNA extracted from the 4,000 year old liver of an Ancient Egyptian priest Called Nekht Ankh. Ancient DNA is DNA isolated from ancient specimen s. ref Bioinformatics and Functional ... as any DNA recovered from biological samples that have not been preserved specifically for later DNA analyses. Examples include the analysis of DNA recovered from archaeological and historical ... on. Unlike modern genetic analyses, ancient DNA studies are characterised by low quality DNA . This places limits on what analyses can achieve. Furthermore, due to degradation of the DNA molecules ..., upper limits exist beyond which no DNA is deemed likely to survive. Current estimates suggest that in optimal ... DNA , for example, from Cretaceous dinosaur remains, have been proven to be wrong, with results stemming from sample or extract contamination, as opposed to authentic extracted DNA. History of Ancient DNA studies Arguably the first aDNA study was in 1984, with a publication by Russ Higuchi and colleagues at Berkeley that was to revolutionise the scope of molecular biology , traces of DNA from a museum ... R, Bowman B, Freiberger M, Ryder OA, Wilson AC title DNA sequences from the quagga, an extinct member ... to sequence such DNA through bacterial cloning were an effective brake on the development of the field of ancient DNA aDNA . However, with the development of the Polymerase chain reaction Polymerase ... name pmid3431465 cite journal author Mullis KB, Faloona FA title Specific synthesis of DNA in vitro ... Saiki RK, Gelfand DH, Stoffel S, et al. title Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase journal Science volume 239 issue 4839 pages 487 91 year 1988 month January ... abr. SPEX amplification was introduced in 2007 to address post mortem DNA modification damage ... of ancient DNA reveals C U type base modification events as the sole cause of post mortem miscoding ... more details
of defined protein antigen s such as tetanus or diphtheria toxoid or RecombinantDNArecombinant ... and recombinant adenovirus vectors. ref name Lewis1999 The method of delivery determines the dose of DNA ... Infections rowspan 2 colspan 3 Method of Immunization DNA Vaccine Recombinant protein ... raised by DNA vaccination are lower than those obtained after vaccination with a recombinant protein. However, DNA immunization induced antibodies show greater affinity to native epitopes than recombinant ... response. Antibody can be induced after just one vaccination with DNA, whereas recombinant protein ... natural infection or recombinant protein immunization. Antibody responses generated by DNA are useful ... Plasmid DNA and Boosting with Antigen Expressing Recombinant Poxvirus 1 2 journal The Journal of Immunology ...Image Making of a DNA vaccine.jpg thumb 250px right The making of a DNA vaccine. DNA vaccination is a technique ... DNADNA to produce an immunological response . Nucleic acid vaccines are still experimental, and have ... tumour models. DNA vaccines have a number of advantages over conventional vaccines, including ... HL, Pertmer TM title DNA vaccines for viral infections basic studies and applications journal Adv. Virus ... title DNA vaccines technology and application as anti parasite and anti microbial agents journal Adv ... H sub and antibody responses, but not killer T cell responses. DNA vaccines are third generation vaccines , and are made up of a small, circular piece of bacterial DNA called a plasmid that has been ... DNA is injected into the cells of the body, where the inner machinery of the host cells reads the DNA ..., which then triggers a range of immune responses. ref name Robinson2000 ref name Alarcon1999 These DNA ... bird flu DNA vaccine tt ref cite news first Kirsty last Barnes coauthors title First positive results for DNA based flu vaccine date 2004 06 07 publisher url http www.in pharmatechnologist.com news ng.asp?n 68225 powermed bird flu vaccine dna work in PharmaTechnologist pages accessdate language ref ... more details
Onesource date June 2009 DNA end or sticky end refers to the properties of the end of a molecule of DNA or a recombinantDNA molecule. The concept is important in molecular biology , especially in Clone genetics cloning or when subcloning inserts DNA into vector DNA. All the terms can also be used in reference ... ends can anneal, even those from two different organisms. This bondage is temporary however, and DNA ... to join the two molecules together. Single stranded DNA molecules A single stranded non circular DNA molecule has two non identical ends, Directionality molecular biology the 3 end and the 5 end ... atoms in the deoxyribose , which is a sugar forming an important part of the backbone of the DNA molecule. In the backbone of DNA the 5 carbon of one deoxyribose is linked to the 3 carbon of another ..., and so forth. Variations in double stranded molecules When a molecule of DNA is double stranded, as DNA ... DNA end of a double stranded molecule is called a blunt end . In a blunt ended molecule both strands terminate in a base pair . Blunt ends are not always desired in biotechnology since when using a DNA ... subcloning, it also has the disadvantage of potentially inserting the insert DNA in the opposite ... is an example of a small piece of blunt ended DNA 5 font color red CTGATCTGACTGATGCGTATGCTAGT font ... by various overhangs . An overhang is a stretch of unpaired nucleotide s in the end of a DNA molecule ... often adenosine and is created as a 3 overhang by some DNA polymerase s. Most commonly this is used in cloning PCR products created by such an enzyme. The product is joined with a linear DNA ... they cut DNA. Very often they cut the two DNA strands four base pairs from each other, creating a four ... endonucleases usually create different overhangs, it is possible to cut a piece of DNA with two different enzymes and then join it with another DNA molecule with ends created by the same enzymes. Since ... each single strand of DNA, we typically see adenine pair with thymine , and cytosine pair with guanine ... more details
DNADNA hybridization generally refers to a molecular biology technique that measures the degree of genetic similarity between pools of DNA sequences. It is usually used to determine the genetic distance between two species . When several species are compared that way, the similarity values allow the species to be arranged in a phylogenetic tree it is therefore one possible approach to carrying out molecular systematics . Charles Sibley and Jon Ahlquist , pioneers of the technique, used DNADNA hybridization to examine the phylogenetic relationships of avians the Sibley Ahlquist taxonomy and primates. ref http evolution.berkeley.edu evolibrary article 0 history 26 Genetic Similarities Wilson, Sarich, Sibley, and Ahlquist ref ref cite journal title The Phylogeny of the Hominoid Primates, as Indicated by DNADNA Hybridization author C.G. Sibley and J.E. Ahlquist journal Journal of Molecular ... DNA hybridization in the apes Technical issues ref DNA sequencing and computational comparisons ... DNADNA hybridization to study complex microbial ecosystems author S.S. Socransky, A.D. Haffajee ... The DNA of one organism is labeled, then mixed with the unlabeled DNA to be compared against. The mixture is incubated to allow DNA strands to dissociate and reanneal, forming hybrid double stranded DNA ..., a process known as DNA melting . To assess the melting profile of the hybridized DNA, the double stranded DNA is bound to a column and the mixture is heated in small steps. At each step, the column ... labeled DNA comes off the column reflects the amount of similarity between sequences and the self ... . Fundamentals of Molecular Evolution. a good text on these topics See also DNA melting Temperature gradient gel electrophoresis Category Molecular biology Category DNA fr Hybridation de l ADN hu DNS DNS hibridiz ci nl DNADNA hybridisatie ja DNADNA pt Hibridiza o de DNADNA sv DNADNA hybridisering tr DNADNA hibridizasyon ... more details
Encyclopedia
top
